Skip to main content

Table 1 Primers for RT-PCR and real-time RT-PCR

From: Upregulation of Toll-like receptor (TLR) expression and release of cytokines from P815 mast cells by GM-CSF

Target
gene
Forward sequence (5'-3') Reverse sequence (5'-3') AS (bp) AT (°C) GA
TLR3 GGTGGTCCCGTTAATTTCCT CCCGAAAACATCCTTCTCAA 240 56 NM_126166
TLR7 TGGAAATTTTGGACCTCAGC TTGCAAAGAAAGCGATTGTG 262 52 NM_133211
TLR9 TGCAGGAGCTGAACATGAAC TAGAAGCAGGGGTGCTCAGT 297 58 NM_031178
β-actin GCTACAGCTTCACCACCACAG GGTCTTTACGGATGTCAACGTC 288 60 NM_007393
  1. AS = amplicon size; AT = annealing temperature; GA = genbank accession