Skip to main content

Table 3 Oligonucleotides used for mutagenesis reactions to alter NLSs sequences in TWIST.

From: Characterization of sequences in human TWIST required for nuclear localization

Amino acid substituted in NLSs Primer Sequence
K38R 5'CGCGGGGGACGCAGGCGGCGCAGCAGC3'
5'GCTGCTGCGCCGCCTGCGTCCCCCGCG3'
K73R 5'CCCAGGGCAGGCGCGGCAAGAAGT3'
5'ACTTCTTGCCGCGCCTGCCCTGGG3'
K76R 5'CAAGCGCGGCAGGAAGTCTGCGG3'
5'CCGCAGACTTCCTGCCGCGCTTG3'
K77R 5'GCGGCAAGAGGTCTGCGGGCT3'
5'AGCCCGCAGACCTCTTGCCGC3'
  1. K, lysine; R, arginine