| primers |  |  |
---|---|---|---|
Designation | Sequence (5' -> 3') or description | use | Reference(s) |
AtCPSF30 5' | AGATCTATGGAGGATGCTGATGGACTT | Cloning of the AtCPSF30 protein-coding region | This study |
AtCPSF30 3' | CCGGAGATCTATGTCGGGCCTCCATCGATC | Cloning of the AtCPSF30 protein-coding region | This study |
C-ter 30 5' (m9) | AGATCTGGAGCTGGGAGGGGTAGAAGTTTCCGTCAA | Cloning of the AtCPSF30 C-terminal protein-coding region | This study |
N-ter 30 3' (m4) | GGGCCCAGGTCCAGGAAGCTTTGCATGCCTGTACCGACA | Cloning of the AtCPSF30 N-terminal protein-coding region | This study |
AtDcp2 5' | CCGGAGATCTATGTCGGGCCTCCATCGATC3 | Cloning of the AtDcp2 protein-coding region | This study |
AtDcp2 3' | AATTGGGCCCCAAACTGACCAGTCAAGCTGAATTACCAG | Cloning of the AtDcp2 protein-coding region | This study |
 | plasmids |  |  |
designation | source | use | Reference(s) |
Salk clone U61209 | ABRC; corresponds to At5g13570 | Template for amplification of AtDcp2 sequences | Â |
pMAL-AtCPSF30 | Hunt laboratory | Template for amplification of AtCPSF30 sequences | [14] |
pMDC43C1-GFP::AtCPSF160, pMDC43C1-GFP::AtCPSF100, pMDC43C1-GFP-AtCPSF73(I) and GFP-AtCPSF73(II) | Dr. Q. Q. Li (Miami University, Oxford, OH) | Plasmids for the expression of GFP fused Arabidopsis CPSF factors 160, 100, 73CII and 73CI | [30] |
pGD RFP, pGD RFP-NLS, | Dr. Michael Goodin (University of Kentucky, Lexington, KY) | pGD RFP vector was used to express different CPSF 30 clones; pGD RFP-NLS was used as control in GFP fusion studies. | [19] |
pKLX80- AtZFP11-NLS::GFP, pKLX80-CoxII::GFP, pKLX80-ER::GFP | Dinkins laboratory | Â |