Skip to main content

Table 2 Primers and plasmids used for this study

From: Distinctive interactions of the Arabidopsis homolog of the 30 kD subunit of the cleavage and polyadenylation specificity factor (AtCPSF30) with other polyadenylation factor subunits

  primers   
Designation Sequence (5' -> 3') or description use Reference(s)
AtCPSF30 5' AGATCTATGGAGGATGCTGATGGACTT Cloning of the AtCPSF30 protein-coding region This study
AtCPSF30 3' CCGGAGATCTATGTCGGGCCTCCATCGATC Cloning of the AtCPSF30 protein-coding region This study
C-ter 30 5' (m9) AGATCTGGAGCTGGGAGGGGTAGAAGTTTCCGTCAA Cloning of the AtCPSF30 C-terminal protein-coding region This study
N-ter 30 3' (m4) GGGCCCAGGTCCAGGAAGCTTTGCATGCCTGTACCGACA Cloning of the AtCPSF30 N-terminal protein-coding region This study
AtDcp2 5' CCGGAGATCTATGTCGGGCCTCCATCGATC3 Cloning of the AtDcp2 protein-coding region This study
AtDcp2 3' AATTGGGCCCCAAACTGACCAGTCAAGCTGAATTACCAG Cloning of the AtDcp2 protein-coding region This study
  plasmids   
designation source use Reference(s)
Salk clone U61209 ABRC; corresponds to At5g13570 Template for amplification of AtDcp2 sequences  
pMAL-AtCPSF30 Hunt laboratory Template for amplification of AtCPSF30 sequences [14]
pMDC43C1-GFP::AtCPSF160, pMDC43C1-GFP::AtCPSF100, pMDC43C1-GFP-AtCPSF73(I) and GFP-AtCPSF73(II) Dr. Q. Q. Li (Miami University, Oxford, OH) Plasmids for the expression of GFP fused Arabidopsis CPSF factors 160, 100, 73CII and 73CI [30]
pGD RFP, pGD RFP-NLS, Dr. Michael Goodin (University of Kentucky, Lexington, KY) pGD RFP vector was used to express different CPSF 30 clones; pGD RFP-NLS was used as control in GFP fusion studies. [19]
pKLX80- AtZFP11-NLS::GFP, pKLX80-CoxII::GFP, pKLX80-ER::GFP Dinkins laboratory   [20, 22]