Skip to main content

Table 1 Deleted MAL2 yeast two-hybrid constructs, primer sequences and MAL2 regions deleted

From: Mucin 1 (MUC1) is a novel partner for MAL2 in breast carcinoma cells

Construct PCR Primer Sequences (5'-3') MAL2 region deleted
pAS2-1MAL2ΔN
pACT2MAL2ΔN
CATGCCATGGCCTACTCGGGCGCCTTCGTC
CCGCTCGAGTTACGGTCGCCATCTTCGTAA
amino acids
1–34
pAS2-1MAL2
ΔNTM1
CCGGAATTCTCCTCCAATGTTCCTCTACC
CCGCTCGAGTTACGGTCGCCATCTTCGTAA
amino acids
1–55
pAS2-1MAL2
ΔNTM12
CCGGAATTCCTCTCTGGAATGGTGGCT
CCGCTCGAGTTACGGTCGCCATCTTCGTAA
amino acids
1–86
pAS2-1MAL2
ΔNTM123
CCGGAATTCGAAGCAGCAGCCACATCC
CCGCTCGAGTTACGGTCGCCATCTTCGTAA
amino acids
1–119
pAS2-1MAL2
ΔNTM1234
CCGGAATTCGCTTTACGAAGATGGCGACCG
CCGCTCGAGTTACGGTCGCCATCTTCGTAA
amino acids
1–169