Skip to main content

Table 1 Sets of primers and corresponding amplicon sizes of target sequences

From: DNA moves sequentially towards the nuclear matrix during DNA replication in vivo

Amplicon Forward Primer Reverse Primer Amplicon Length
A TGGCAAACATACGCAAGGGA GCGAAACACACCCCTGGAAA 275 pb
B GAGGACAGTTAGTGCTGTAGGGTTG CCTCCAACGAAGTTCCCAGAAT 547 pb
C TCCTTTGTAACCAGGCAAGTGG CCCATTTCCCAGATCCTTCACTCT 374 pb
D CCCAGGGTCAGAGTATATCAGTGC CGCTGAACGTATGTCTGAGTCA 305 pb
E TGGTAGGCAGAGATGTGAGGAAAG CCTGTTGTCCTAATGCTGGTCCTA 382 pb
F CTGATCTTCAGGCAATATGGCAGG TTGGCTGATGTCGTCTGGACA 393 pb
G AAGGATAGGTGCTTGGCTGACA GCCCTAACCCTGTGTGTGTATCTTG 504 pb
h GATCACGTAACAACCCTGTCAGCT CCTTCACAGCACCCGTCATACA 263 pb
i GGTGCTGGGAATTTGACTAAGGC TAAACTCAGGTGACAGGCTACGGC 465 pb
j AGGAACCAGGGAATCGAGTGCT AACTTGCGGGTGTTCTCTCCTT 392 pb
k TGTCAGCATGATGGTGGCTCA CTCGATTTGCCATGTCCTGTCT 252 pb
l GGGCTGGGTCCATATTGCTTGA ATGCTTTGGGCTTGCCTGAAG 373 pb
m ACGACTTCCCTTCCTATCCACAG GTAGAAAGTCGTTCTGGTTGCCAC 234 pb
n CCCTAATCTTGCTGTGGTTTGG TGAGAGCTGGGCAGACATCAA 355 pb
O GGTGACAGTTGACAGAGAGCCTTC GCTCCATGCTGACCTTGAAGTCTA 272 pb
  1. Sets of primers and corresponding amplicon sizes defining fifteen target sequences along the 162 kbp genomic region of chromosome 14 containing members of the rat albumin gene family.