Skip to main content

Table 5 Target sequences corresponding to four unrelated genes from separate chromosomes

From: DNA moves sequentially towards the nuclear matrix during DNA replication in vivo

Amplicon Chromosome Forward Primer Reverse Primer Amplicon Length
GFAP 10 TCCAGCCCGTCCCTCAATAA TCCCGAAGTTCTGCCTGGTAA 418 bp
CD23 12 TAGGAGACGATGCTGCTGTGCA CGTGGGAAGAGGATCAGACAAGAA 284 bp
MPZ 13 CTTGCCCCTACCCCAGCTAT TCTCCTTGGCTGGCTCTCAAT 184 bp
Fyn 20 ACACAATGCTGATCTAGTCGTGGC CACATCTGTGTTCATCACTGTCCG 340 bp
  1. Sets of primers and corresponding amplicon sizes defining target sequences in four unrelated genes located in different rat chromosomes. All the amplicons were designed for the 5' end of the corresponding gene.