Skip to main content

Table 1 Primers for RT-PCR analysis

From: Localization of chondromodulin-I at the feto-maternal interface and its inhibitory actions on trophoblast invasion in vitro

Genbank acc no. Gene 5'-Forward primer-3' 5'-Reverse primer-3' Size (bp)
NM_010701 ChM-I CATCGGGGCCTTCTACTTCT CTGCGTCGTCCTGAACATTGGG 584
NM_010088 Prl8a2 TGAATGTCAAACAGGAGAGAA CAATCTTGCCCAGTTATGCGG 628
NM_008864 Prl3d1 GCTTCCATCCATACTCCAG TCGTTCTGAAAGACAACTCG 419
NM_009309 Brachyury CTGCAGTCCCATGATAACTGGTCTAGC CCAGGATTTCAAAGTCACATATATGTTGTAG 717
NM_009931 Col4a1 TGTCCAAGGCAACGAGCGTG TGTTCTTCTCATGCACACTTGG 583
NM_007742 Col1a2 GAACGGTCCACGATTGCATG GGCATGTTGCTAGGCACGAAG 401
NM_001025250 VEGF-A CAGAGAGCAACATCACCATGC TCCTCGAAGGATCTCCTCTTCC 313, 445
NM_010612 Flk-1 CACAGACACCACCGTGTACTCC CTCCAAGGTAGACAGACTCGGC 516
NM_010228 Flt-1 TATGGTCTGTGTGCTTAGGTCG ACAGGACCATCTATGGTCTTCC 476
NM_008006 FGF-2 AGCGGCATCACCTCGCTTCC TGGAAGCAGTATGGCCTTCTGTCC 433
NM_010206 FGFR-1 AGAGACCAGCTGTGATGA GGCCACTTTGGTCACACG 461
NM_010512 IGF-I GGACCAGAGACCCTTTGCGGGG GGCTGCTTTTGTAGGCTTCAGTGG 210
NM_010513 IGF-IR ATGCTGTTTGAACTGCAGCGCATGTGCTGG CCGCTCGAGCTTGCGGCCCCCGTTCAT 354
NM_010809 MMP-3 GAAATGCAGAAGTTCCTCGG GAGTTCCATAGAGGGACTGA 878
NM_013599 MMP-9 TGTCATCCAGTTTGGTGTCG TAGGGCAGAAGCCATACAGT 433
NM_008607 MMP-13 TGAAGAGACTGAGCGCTGCG ATTCTTCCATGTGGTTCCAGCC 461
NM_008608 MMP-14 ATCATTGAGGTGGATGAGGAGG CAGCCAACCAGGTACACTTGG 614
NM_001044384 TIMP-1 AGTAAGGCCTGTAGCTGTGCC ACGAGGACCTGATCCGTCC 467
NM_011594 TIMP-2 AGCAGTGAGCGAGAAGGAGG TCACTTCTCTCGATGCAGGC 450
NM_011595 TIMP-3 GCTACTGCAGCTGGTACCG TTGGACTTCTGCCAACTTCC 518
NM008084 GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 452