Skip to main content

Table 2 Primers for cDNA fragment cloning

From: Localization of chondromodulin-I at the feto-maternal interface and its inhibitory actions on trophoblast invasion in vitro

Genbank acc no. Gene 5'-Forward primer-3' 5'-Reverse primer-3' Size
(bp)
NM_010701 ChM-I GGGTCAATGGAAATAGATGCT ACACCATGCCCAGGATGCGG 739
NM_011595 TIMP-3 GCTACTGCAGCTGGTACCG TTGGACTTCTGCCAACTTCC 515
NM_013599 MMP-9 GATGCTATTGCTGAGATCCAGG GGAAGATGTCGTGTGAGTTCC 433
NM_008864 Prl3d1 GACCTGTATACTCGTTTGGC TCGTTCTGAAAGACAACTCG 551
NM_010088 Prl8a2 TGAATGTCAAACAGGAGAGAA CAATCTTGCCCAGTTATGCGG 628
NM_001025250 VEGF-A *GAAACCATGAACTTTCTGCTCTC *GGTGAGAGGTCTGGTTCCCG 624
  1. * The following sequence was added at the 5'-end of the primer. Added sequence: ATAAGAATGCGGCCGC