Skip to main content

Table 3 List of Primers used in qRT-PCR

From: New insights in osteogenic differentiation revealed by mass spectrometric assessment of phosphorylated substrates in murine skin mesenchymal cells

Gene 5′- 3′ nucleotide sequence
mBMP-2 F TCTTCCGGGAACAGATACAGG
mBMP-2 R TGGTGTCCAATAGTCTGGTCA
mOsterix F ATGGCGTCCTCTCTGCTTG
mOsterix R TGAAAGGTCAGCGTATGGCTT
mRunX-2 F GACTGTGGTTACCGTCATGGC
mRunX-2 R ACTTGGTTTTTCATAACAGCGGA
mDlx5 F CACCACCCGTCTCAGGAATC
mDlx5 R GCTTTGCCATAAGAAGCAGAGG
mTGFb1 F CTCCCGTGGCTTCTAGTGC
mTGFb1 R GCCTTAGTTTGGACAGGATCTG
mSMAD-2 F ATGTCGTCCATCTTGCCATTC
mSMAD-2 R AACCGTCCTGTTTTCTTTAGCTT
mTGFbR2 F CCGCTGCATATCGTCCTGTG
mTGFbR2 R AGTGGATGGATGGTCCTATTACA
mTwist1 F GGACAAGCTGAGCAAGATTCA
mTwist1 R CGGAGAAGGCGTAGCTGAG
mSox9 F GAGCCGGATCTGAAGAGGGA
mSox9 R GCTTGACGTGTGGCTTGTTC
mCol4a1 F CTGGCACAAAAGGGACGAG
mCol4a1 R ACGTGGCCGAGAATTTCACC
mCol-1 F GCTCCTCTTAGGGGCCACT
mCol-1 R ATTGGGGACCCTTAGGCCAT
mCol-2 F CAGGATGCCCGAAAATTAGGG
mCol-2 R ACCACGATCACCTCTGGGT
  1. List of primers used to amplify the cDNA in order to investigate changes in mRNA upon BMP2 treatment in qRT-PCR. F: forward; R: reverse.