Skip to main content

Table 1 RT-PCR primer pair sequences for selected genes

From: THOC5, a member of the mRNA export complex, contributes to processing of a subset of wingless/integrated (Wnt) target mRNAs and integrity of the gut epithelial barrier

Gene Acession number Forward primer Reverse primer RT-PCR (spliced) RT-PCR (unspliced)
Alb (exon2-exon3) NM_009654.3 CAAGAGTGAGATCGCCCATCG TTACTTCCTGCACTAATTTGGCA x  
Ascl2(exon1-exon2) NM_008554.3 AAGCACACCTTGACTGGTACG AAGTGGACGTTTGCACCTTCA x  
Birc5 (exon3-exon 4) NM_009689.2 AGCATAGAAAGCACTCCCCTG CCACTGTCTCCTTCTCTAAGATCC x  
Fn1 (exon41-exon43) NM_001276408.1 TTCAAGTGTGATCCCCATGAAG CAGGTCTACGGCAGTTGTCA x  
GAPDH (exon2-exon3) NM_008084.2 AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA x  
GusB (exon1-exon2) NM_010368.1 CCGACCTCTCGAACAACCG GCTTCCCGTTCATACCACACC x  
Mmp2 (exon1-exon2) NM_008610.2 CAAGTTCCCCGGCGATGTC TTCTGGTCAAGGTCACCTGTC x  
Ptgs2 (exon8-exon9) NM_011198.3 TTCAACACACTCTATCACTGGC AGAAGCGTTTGCGGTACTCAT x  
Snai1 (exon2-exon3) NM_011427.2 CAAGGAGTACCTCAGCCTGG GGTCAGCAAAAGCACGGTT x  
Sox9 (exon2-exon3) NM_011448.4 CGGAACAGACTCACATCTCTCC GCTTGCACGTCGGTTTTGG x  
Sox9 (exon2-intron2) NC_000077.6 AGTCGGTGAAGAACGGACAAG GAATGCAAAGTCAGATACTTCTG   x
Beta-actin (exon4-exon5) NM_007393.3 AACACCCCAGCCATGTACGTAG GTGTTGGCATAGAGGTCTTTACGG x  
Beta-actin (exon4-Intron4) AC_000027.1 GCTGTGCTATGTTGCTCTAGACTT TTTAGATGGAGAAAGGACTAGGC   x
THOC5 (exon1- exon7) NM_172438.3 TCTGCCTTTTCACCTGGAAG CTCGGTACTTTTCTGCCAGC x  
Trf (exon1-exon2) NM_133977.2 ACACACACACCGAGAGGAT GGTATTCTCGTGCTCTGACAC x  
Wnt11 (exon6-exon7) NM_009519.2 GGTGGTACACCGGCCTATG TCACTGCCGTTGGAAGTCTTG x  
  1. Alb (exon2-exon3): albumin (131nt); Ascl2 (exon1-exon2): Achaete scute complex homolog 2 (115nt); ; Birc5 (exon3-exon4): Baculoviral IAP repeat-containing 5 (311nt); Fn1 (exon41-exon43): fibronectin1 (154nt); GAPDH (exon2-exon3): glyceraldehyde-3 phosphate dehydrogenase (123nt); GusB (exon1-exon2): glucouronidase beta (169nt); Mmp2 (exon1-exon2): matrix metallopeptidase 2 (171nt); Ptgs2 (exon8-exon9): prostaglandin-endoperoxidase synthase 2 (271nt); Snai1 (exon2-exon3): snail homolog 1 (179nt); Sox9 (exon2-exon3): SRY-box containing gene 9 (163nt); Sox9 (exon2-intron2) (235nt); beta-actin (exon4-exon5): (509nt); beta-actin (exon4-intron4) (191nt); THOC5 (exon1-exon7): THO complex subunit 5 homolog (643nt); Trf (exon1-exon2): transferrin (125nt); Wnt11 (exon6-exon7): wingless-related MMTV integration site 11 (183nt); (): product size.