Skip to main content

Table 2 Primers and probes for TaqManR analysis

From: Hernia fibroblasts lack β-estradiol induced alterations of collagen gene expression

target primers/probes sequence (5'-3')
cyclophylline 5-HCYP GTCTCCTTTGAGCTGTTTGC
  3-HCYP CCTTATAACCAAATCCTTTCTCTCCA
  HCYP-FAM TGCTCAGAGCACGAAAATTTTTTGCTGTC
Col1A1 5-COL1A1 ACAGCCGCTTCACCTACAGC
  3-COL1A1 TCAATCACTGTCTTGCCCCA
  COL1A1-FAM ACTGTCGATGGCTGCACGGAGTCACAC
Col3A1 5-COL3 TCTTGGTCAGCTCTATGCGGA
  3-COL3 TGTCATCGCAGAGAACGGATC
  COL3-FAM AGAGATGTCTGGAAGCCAGAACCATGCC
MMP 2 5-MMP2 CGCTCAGATCCGTGGTGAG
  3-MMP2 CTTGTCACGTGGGCGTCACA
  MMP2-FAM CTTCAAGGACCGGTTCATTTGGCG