Skip to main content

Table 2 Real time PCR primer pairs

From: Differential growth factor regulation of aspartyl-(asparaginyl)-β-hydroxylase family genes in SH-Sy5y human neuroblastoma cells

Primer* Sequence (5'→3') Amplicon Size (bp)
18 S For GGACCAGAGCGAAAGCATTTGCC  
18 S Rev TCAATCTCGGGTGGCTGAACGC 50
AAH For GGGAGATTTTATTTCCACCTGGG  
AAH Rev CCTTTGGCTTTATCCATCACTGC 256
Humbug For GCTGGGTTGATTGAGGATGTGTG  
Humbug Rev GCAGGGGGAAAAAGTCACCTTATC 301
Junctin For CCTGAGTCAAGGAAGGAAAGTAAG  
Junctin Rev GCCGTTTCTTTTCTGGGTATTTCC 308
IRS-1 For TGCTGGGGGTTTGGAGAATG  
IRS-1 Rev GGCACTGTTTGAAGTCCTTGACC 68
IRS-2 For AAAATTGGCGGAGCAAGGC  
IRS-2 Rev ATGTTCAGGCAGCAGTCGAGAG 64
IRS-4 For CCGACACCTCATTGCTCTTTTC  
IRS-4 Rev TTTCCTGCTCCGACTCGTTCTC 74
  1. *For-forward; Rev-reverse; AAH = aspartyl (asparaginyl)-β-hydroxylase; IRS = insulin receptor substrate