Skip to main content

Table 1 Primers used for the generation of the constructs used in this study.

From: A yeast three-hybrid system that reconstitutes mammalian hypoxia inducible factor regulatory machinery

Gene   Primer
Syk Fw 5'GAATTCAACCACCTGCCCTTCTTT 3'
  Rv 5'GAATTCTGCCGATTTTTTGACATGG 3'
VHL Fw 5'AGCTGAATTCCTGCGCTCGGTGAACTCGCGC3'
  Rv 5'AGCTCTCGAGGGATCCTCAAGTATACACTGGCAGTGTGATATTG3'
FcεRIγ Fw 5'GAATTCCGACTGAAGATCCAAGTGCGAAAG 3'
  Rv 5'GAATTCCTACTGTGGTGGTTTCTCATGCTTCAG 3'
Lck Fw 5'TGATCAGCGGCCGCCATGGGCTGTGGCTGCAGCTCACAC 3'
  Rv 5'GCGGCCGCTGATCATCAAGGCTGAGGCTGGTACTGGCC 3'
EGLN3 Fw 5'AGCTAAGCTTACCATGAGATCTTCTAGAATGCCCCTGGGACACATCATGAGG 3'
  Rv 5'GACTGAATTCTGATCAGTCGACGTCTTCAGTGAGGGCAGATTCAG 3'