Skip to main content

Table 2 Primers used in this study.

From: The CMV early enhancer/chicken β actin (CAG) promoter can be used to drive transgene expression during the differentiation of murine embryonic stem cells into vascular progenitors

Primer Sequence Purpose
SDC1for ATGAGACGCGCGGCGCTC RTPCR
SDC1rev GGCGTAGAACTCCTCCTGC RTPCR
SDC2for GCCTTGATGGCCTGTGTGTC RTPCR
SDC2rev GCATAAAACTCCTTAGTGGG RTPCR
SDC3for CGTGGCTGACGTAAGGACC RTPCR
SDC3rev CTCTAGTATGCTCTTCTGAA RTPCR
SDC4for CGAGAGACAGAGGTCATCGAC RTPCR
SDC4rev TGCGTAGAACTCATTGGTGG RTPCR
bactfor ATGGATGACGATATCGCTGCG RTPCR
bactrev CTAGAAGCATTTGCGGTGCAC RTPCR
SDC2ecoRIfor TATATAGAATTCGTAGGAGCCACATCCCTG SDC2 cloning
SDC2ecoRIrev TATATAGAATTCTTATGCATAAAACTCCTTAGTGG SDC2 cloning
SDC4ecoRIfor TATATAGAATTCGACTGGTTTGCGCTGTTGAA SDC4 cloning
SDC4ecoRIrev TATATAGAATTCTCATGCGTAGAACTCATTGGT SDC4 cloning
IRESdelfor GATATCCGCTAGCGCTACCGGACT Deletion of CMV promoter from pIRES2-EGFP
IRESdelrev ATGCATGGCGGTAATACGGT Deletion of CMV promoter from pIRES2-EGFP
GFPfor TATATAAAGCTTGCCACCATGGTGAGCAAG GFP cloning
GFPrev TATATAGGATCCATGATCTAGAGTCGCGGCC GFP cloning