Skip to main content

Table 6 siRNA oligos and the primers for real time RT-PCR

From: A morphologic and semi-quantitative technique to analyze synthesis and release of specific proteins in cells

Gene siRNA(5′-3′) Primer pairs(5′-3′) Size(bp)
Bcl-2 GUACAUCCAUUAUAAGCUGdtdt GTACCTGAAACCGGCACCTGCAC 150 bp
CAGCUUAUAAUGGAUGUACdtdt GCTCCACAGCCTCCCATTGCC
MMP-9 CAUCACCUAUUGGAUCCAAdtdt CAGCCGGGACGCAGACATCG 128 bp
UUGGAUCCAAUAGGUGAUGdtdt GGGCGTCTCCCTGAATGCCG
IgG CCAAGGACACCCUCAUGAUdtdt GTGACGGTGTCGTGGAACT 94 bp
AUCAUGAGGGUGUCCUUGGdtdt ACGCTGCTGAGGGAGTAGAG
Scramble UUCUCCGAACGUGUCACGUdtdt   
ACGUGACACGUUCGGAGAAdtdt
GAPDH   TAGAGCGGCCGCCATGTTGC 123 bp
CCTGACTTCCCCGCCACACGC