Skip to main content

Advertisement

Table 1 Primers used for real-time qPCR to estimate mRNA levels of particular genes

From: Effects of partial silencing of genes coding for enzymes involved in glycolysis and tricarboxylic acid cycle on the enterance of human fibroblasts to the S phase

Gene name: Primer sequence Reference genes
HK2 F: 5’- CGAGGTCTGAGCAAGGAGAC GUSB, HPRT
R: 5’- GTCCGGGGTAGCACACAC
GPI F: 5’- GCTTTGCTGCGTACTTCCA TBP, ACTB
R: 5’- GTCCACACGGGTTCCAGA
PFKM F: 5’- GCCATCAGCCTTTGACAGA GUSB, HPRT
R: 5’- CTCCAAAAGTGCCATCACTG
ALDOA F: 5’- TCCTCTAGCCCGTGGAATC
R: 5’- AAGACGATGGCAGGGATG
TBP, ACTB
TPI1 F: 5’- GCTCAGAGCACCCGTATCAT GUSB, HPRT
R: 5’- CACAAGGAAGCCATCCACAT
GAPDH F: 5’- ACGGGAAGCTTGTCATCAAT TBP, ACTB
R: 5’- CATCGCCCCACTTGATTTT
PGK1 F: 5’- CTCATGGATGAGGTGGTGAA TBP, ACTB
R: 5’- CACAGCAAGTGGCAGTGTCT
PGAM1 F: 5’- AGGCGCTCCTATGATGTCC TBP, ACTB
R: 5’- CGATCCTTACTGATGTTGCTGT
ENO1 F: 5’- CAACCAGCTCCTCAGAATTGA GUSB, HPRT
R: 5’- GCCAAGGGGTTTCTGAAGTT
PKM F: 5’- ACCCTCCACTCAGCTGTCC TBP, ACTB
R: 5’- CCTGGAGGTGCTGCAGTAGT
LDHA F: 5’- GGTGGATGTTTACCGTGTGTT TBP, ACTB
R: 5’- TGGATCCCAGGATGTGACTC
CS F: 5’- TCCGACCCTTACCTGTCCTT TBP, ACTB
R: 5’- ACTTCCTGATTTGCCAGTCC
ACO2 F: 5’- AGATTGTGTATGGACACCTGGA HPRT, GUSB
R: 5’- TACGACTTGCCTCGCTCAAT
IDH2 F: 5’- CCATCATCTGCAAAAACATCC HPRT, GUSB
R: 5’- CCAATGGTGATGGGCTTG
IDH3B F: 5’- GCCCAATCTCTATGGGAACA TBP, ACTB
R: 5’- CAGGGACCACACCAGCTC
OGDH F: 5’- AGAGTCCCCTTCCCCTGAG TBP, ACTB
R: 5’- GCTTCTACCAGGGACTGTCC
SUCLG2 F: 5’- AGCCAGCCAACTTCTTGGA TBP, ACTB
R: 5’- GGATGGCTTCAACCTTAGGA
SDHA F: 5’- CAGCACAGGGAGGAATCAAT HPRT, GUSB
R: 5’- CTGCTCCGTCATGTAGTGGA
FH F: 5’- TGAATGTTTTCAAGCCAATGAT HPRT, GUSB
R: 5’- CCACCACGCAGTTTTCTGTA
MDH2 F: 5’- CAGGACCAGCTGACAGCAC TBP, ACTB
R: 5’- AGCCTGCTCCGGCTTTAG