Skip to main content

Table 1 Primer pairs for qPCR on HL-1 cell and mouse brain cDNA

From: Distinct expression patterns of HCN channels in HL-1 cardiomyocytes

Protein Gene Primer Sequence (5‘→3‘) T m Amplicon size
GAPDH gapdh Forward GGTATCGTGGAAGGACTCATG 62 °C 150 bp/284 bp
Reverse GCTGCCAAGGCTGTGGGC
HCN1 hcn1 Forward ACTGTGGGCGAATCCCTGG 62 °C 184 bp
Reverse CCACCAGCAGCTGTGCAGA
HCN2 hcn2 Forward GGAGAATGCCATCATCCAGG 62 °C 149 bp
Reverse CAGCAGGCTGTGGCCATGA
HCN3 hcn3 Forward TGGGAACCACTGGTGCACG 62 °C 141 bp
Reverse TGAGCGTCTAGCAGATCGAG
HCN4 hcn4 Forward CACGACCTCAACTCAGGCG 62 °C 153 bp
Reverse CAGCGGGGTCCATATAACAG
  1. Primer sequences and amplicon sizes are based on mouse sequences (accession numbers: NM_008084.2 (gapdh), NM_010408.3 (hcn1), NM_008226.2 (hcn2), NM_008227.1 (hcn3), and NM_001081192.1 (hcn4)). Amplicon sizes of gapdh fragments are indicated for cDNA (150 bp) and genomic DNA (284 bp).