Skip to main content

Table 1 Sequences of primers used for qPCR

From: Release of endothelial cell associated VEGFR2 during TGF-β modulated angiogenesis in vitro

Gene   Primer sequence
sVEGFR2a F GCTTTGCTCAGGACAGGAAGAC
R GGTCCAGAGTGACTGCCCTA
VEGFR2a F GCTTTGCTCAGGACAGGAAGAC
R CATGCGCTCTAGGACTGTGA
HPRTb F CGCGCCAGCCGGCTACGTTA
R GGCCACAATGTGATGGCCACCC
GAPDHb F CAGCAACAGGGTGGTGGACC
R AGTGTGGCGGAGATGGGGCA
  1. abovine ortholog of human primer sequences derived from [25]
  2. bgenerated using PrimerBLAST http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome