Skip to main content

Table 1 Primers for mRNA expression

From: Hinokitiol induces DNA demethylation via DNMT1 and UHRF1 inhibition in colon cancer cells

Genes Primer sequences (5′ → 3′) Annealing temp. (°C) Product size (bp)
DNMT1 F:AGACTACGCGAGATTCGAGTC 60 171
R:TTGGTGGCTGAGTAGTAGAGG
MGMT F:ACCGTTTGCGACTTGGTACT’ 54 268
R:CGGGGAACTCTTCGATAGCC
AKR1B1 F:CCCATGTGTACCAGAATGAGAA’ 58 362
R:CTGGAGATGGTTGAAGTTGGAG’
CHST10 F:GTGTGATTGGACACCACGAG’ 58 176
R:ATACAGGCGTCGGATGTCTC’
BTG4 F:GCAAGGAACCTCGTGTCATT 58 159
R:GCGAGCCATGGTAAGTGTTT’
SPG20 F:CCAACTGGAACAGAGCAGAAG’ 58 160
R:TTAGCCCTTTTTCCACGTTTT’
β-actin F:AGAGCTACGAGCTGCCTGAC 60 184
R:AGCACTGTGTTGGCGTACAG