Skip to main content

Table 2 Primers for quantitative methylation-specific PCR (QMSP)

From: Hinokitiol induces DNA demethylation via DNMT1 and UHRF1 inhibition in colon cancer cells

Gene Primer sequences (5′ → 3′) Annealing temp. (°C) Product size (bp) Location Gene bank
NEUROG1 F:TATGTAAATATTCGGGCGTTGTAC 58 199 (−155 ~ +43) NC_000005.9
R:GATCTCCTAAATAATATCGCCGAC
TAC1 F:TTAGATTTGTAGACGGAAGTAGGTC 58 139 (−135 ~ +3) NC_000007.13
R:GTAATTAAAAATTTCCGAAACGAT
MGMT F:GTTTGTATTGGTTGAAGGGTTATTT 58 109 (−292 ~ −184) NC_000010.10
R:CTAAAACAATCTACACATCCTCACT
AKR1B1 F:CGGAAGAAGTATTTTCGTCGA 58 166 (−120 ~ +45) NC_000007.13
R:CAATACGATACGACCTTAACCG
CHST10 F:TTTTGTAGCGGTAGAAAGGGAGATTCG 58 198 (−125 ~ +72) NC_000002.11
R:GACTTTAAAAACCAAAACGCCGAC
BTG4 F:GTATAATACGCGTAGTTGGGTTAGC 58 171 (−422 ~ −252) NC_0000011.9
R:AAAAAAACGAAAAAAACCTAAACG
ELOVL4 F:GAGTTTAGGTGTTTCGTTTTCGTTC 58 114 (−158 ~ −42) NC_000006.11
R:CCTCCCTCCCTAATATTAAAACTCG
EYA4 F:GTTATTCGAGGTTAAATAAAAACGG 58 149 (−198 ~ −50) NC_000006.11
R: ACTTACGCAAAAAAATAAAACGAA
SPG20 F:GTCGAGTAGTCGACGTGGTC 58 168 (−246 ~ −78) NC_000013.10
R:AATAATACGTAAAAAAACGTCCGTC
UNC5C F:GTTTAGGTTTGGCGTATCGC 58 219 (−463 ~ −245) NC_000004.11
R:GCCAAAAAAACGTAAAAAACG
β-actin F:TGGTGATGGAGGAGGTTTAGTAAGT 58 132 (−1645 ~ −1513) NC_000007.13
R: AACCAATAAAACCTACTCCTCCCTTAA