Skip to main content

Table 1 Sequences of primers used in qPCR

From: Intermittent parathyroid hormone (PTH) promotes cementogenesis and alleviates the catabolic effects of mechanical strain in cementoblasts

Gene Forward primer sequence (5’–3’) Reverse primer sequence (5’–3’)
GAPDH GACATCAAGAAGGTGGTGAAGC GAAGGTGGAAGAGTGGGAGTT
ALP CCAACTCTTTTGTGCCAGAGA GGCTACATTGGTGTTGAGCTTTT
BSP TAGGAGTTTCCAGGTTTCTGATGA CTGCCCTTTCCGTTGTTGTC
COL1 CTGGCGGTTCAGGTCCAAT TTCCAGGCAATCCACGAGC
OCN TGCTTGTGACGAGCTATCAG GAGGACAGGGAGGATCAAGT
OPN TAGGAGTTTCCAGGTTTCTGATGA CTGCCCTTTCCGTTGTTGTC
Osterix CTCACCAGGTCCAGGCAACA GGAGCAAAGTCAGATGGGTAAGTAG
Runx2 GGACGAGGCAAGAGTTTCACC GAGGCGATCAGAGAACAAACTAGG