Skip to main content

Table 1 Primer pairs used to assess osteoblast differentiation in the RT-PCR and qRT-PCR amplification

From: Dental pulp pluripotent-like stem cells (DPPSC), a new stem cell population with chromosomal stability and osteogenic capacity for biomaterials evaluation

Gene Accession number Forward primer (5′-3′) Reverse primer (5′-3′) Product size (bp) Use
OCT 3/4 NM_002701 GTGGAGAGCAACTCCGAT G TGCAGAGCTTTGATGTCCTG 122 RT-PCR
qRT-PCR
NANOG NM_024865 CAGAAGGCCTCAGCACCTAC ATTGTTCCAGGTCTGGTTGC 111 RT-PCR
qRT-PCR
ALP NM_000478 GGACATGCAGTACGAGCTGA GTCAATTCTGCCTCCTTCCA 133 RT-PCR
ALP NM_000478 CCGTGGCAACTCTATCTTTGG GCCATACAGGATGGCAGTGA 79 qRT-PCR
COL1 NM_000088 ACTGGTGAGACCTGCGTGTA CAGTCTGCTGGTCCATGTA 263 RT-PCR
COL1 NM_000088 CCCTGGAAAGAATGGAGATGAT ACTGAAACC TCTGTGTCCCTTCA 139 qRT-PCR
OC NM_199173 GTGCAGCCTTTGTGTCCAA GCTCACACACCTCCCTCCT 129 RT-PCR
OC NM_199173 AAGAGACCCAGGCGCTACC T AAC TCGTCACAGTCCGGATTG 110 qRT-PCR
RUNX2 NM_001146038 TTACTGTCATGGCGGGTAAC GGTTCCCGAGGTCCATCTA 220 RT-PCR
RUNX2 NM_001146038 AGCAAGGTTCAACGATCTGAGAT TTTGTGAAGACGGTTATGGTCAA 81 qRT-PCR
VLA4 NM_000885 CGAACCGATGGCTCCTAGTG CACGTCTGGCCGGGATT 115 RT-PCR
ITGα3 NM_002204 TCCGAGTCAATGTCCACAGA GCTGGGCTACCCTATTCCTC 88 RT-PCR
qRT-PCR
ITGαV NM_002210 CCTTGCTGCTCTTGGAAC TC ATTCTGTGGCTGTCGGAGAT 74 RT-PCR
qRT-PCR
GAPDH NM_002046 CTGGTAAAGTGGATATTGTTGCCAT TGGAATCATATTGGAACATGTAAACC 81 RT-PCR
qRT-PCR
  1. OCT-3/4 octamer-binding transcription factor 4, Nanog Nanog homeobox, ALP alkaline phosphatase, COL1 type I collagen, OC osteocalcin, RUNX2 Runt-related protein 2, VLA-4 Integrin alpha4beta1, ITGα3 integrin alpha 3, ITGαV integrin, alpha V, GAPDH glyceraldehyde-3-phosphate dehydrogenase