Skip to main content

Table 2 Primer sequences for qRT-PCR

From: Honokiol improved chondrogenesis and suppressed inflammation in human umbilical cord derived mesenchymal stem cells via blocking nuclear factor-κB pathway

Gene Forward sequence 5′-3′ Reverse sequence 5′-3’
GADPH TGTTGCCATCAATGACCCCTT CTCCACGACGTACTCAGCG
ALP CCACGTCTTCACATTTGGTG AGACTGCGCCTGGTAGTTGT
RUNX-2 AGTGGACGAGGCAAGAGTTTC CCTTCTGGGTTCCCGAGGT
SOX-9 CTTCCGCGACGTGGACAT GTTGGGCGGCAGGTACTG
Aggrecan ACAGCTGGGGACATTAGTGG GTGGAATGCAGAGGT GGTTT
Col2α1 GCCTGGTGTCATGGGTTT GTCCCTTCTCACCAGCTTTG
CEBP AGGAACACGAAGCACGATCAG CGCACATTCACATTGCACAA
FABP4/aP2 TACTGGGCCAGGAATTTGAC GGACACCCCCATCTAAGGTT
Caspase-3 AGAACTGGACTGTGGCATTGAG GCTTGTCGGCATACTGTTTCAG
MMP-1 AGTGACTGGGAAACCAGATGCTGA GCTCTTGGCAAATCTGGCCTGTAA
MMP-9 GCGGAGATTGGGAACCAGCTGTA GACGCGCCTGTGTACACCCACA
MMP-13 TGCTGCATTCTCCTTCAGGA ATGCATCCAGGGGTCCTGGC