Skip to main content

Table 5 Primer sequences used for RT-PCR validation

From: Molecular targets and signaling pathways regulated by nuclear translocation of syndecan-1

GENE PRIMERS (5’TO 3’ORIENTATION): FORWARD/REVERSE
GAPDH ACATCATCCCTGCCTCTACTGG/ AGTGGGTGTCGCTGTTGAAGTC [99]
SDC1 TCTGACAACTTCTCCGGCTC/CCACTTCTGGCAGGACTACA [100]
DOCK8 AGTGCCGAGGACTTTGAGAA/ ATTCTGTTGCCCAGGTGTTC
EGR1 TGACCGCAGAGTCTTTTCCT/ TGGGTTGGTCATGCTCACTA
NEK11 AGAGGATGCCACATCTGACC/ GAAGTGCAACCCAGGACATT
ZNF676 CTGGTCTTCCTGGGTATTGC/ TTGCTCTGGCCAAAACTCTT
CA9 TAAGCAGCTCCACACCCTCT/ TCTCATCTGCACAAGGAACG
COL19A1 GTGGTTTCTGTGGCAGGTTT/AGTCTGCCTCCTCGCAATTA
DACH1 GTGGAAAACACCCCTCAGAA/ CTTGTTCCACATTGCACACC
EGR2 CCTCCTTATTCTGGCTGTGC// CTGGGATCATTGGGAAGAGA
FAP CTTGTCCTGGCTTCAGCTTC/ AGGTGGCAACTCCAAATACG
HS6ST3 GGCTCACTGAGTTCCAGAGG/ TCTAGCTGCTTGGTGTGGTG
IL2RB GCTGATCAACTGCAGGAACA/ TGTCCCTCTCCAGCACTTCT
PIP5KIB CCAGGAATGGAAGGATGAGA/ AATTGTGGTTGCCAAGGAAG
SERPINA3 CCAACGTGGACTTCGCTTTC/CTCTTGGCATCCTCCGTGAA
SERPINB4 TCAGTGAAGCCAACACCAAG/ TGTTGCAGCTTTTTCTGTGG
TNRFS9 CACTCTGTTGCTGGTCCTCA/ CACAGGTCCTTTGTCCACCT
VCAM1 CAGACAGGAAGTCCCTGGAA/ TTCTTGCAGCTTTGTGGATG
ADAMTS5 CCCAGCCTGGACACATTACT/ TTCCCCTGAGCATTTTTCAC
AREG TGGATTGGACCTCAATGACA/ AGCCAGGTATTTGTGGTTCG
CDK20 ATGGCTAAGGTGGCATTGTC/ CGCTCATCCTGAGGGAGTAG
COL1A2 CCTGGTAATCCTGGAGCAAA/ TTACCGCTCTCTCCTTTGGA
CXCL1 AGGGAATTCACCCCAAGAAC/ CACCAGTGAGCTTCCTCCTC
ITGA8 CACATTCTGGTGGACTGTGG/ AATCCCTTGTTGTTGCGTTC
MMP10 GGCTCTTTCACTCAGCCAAC/ GGCTCTTTCACTCAGCCAAC
PCDH18 AGCATCTGCAGCTTTTCCAT/ AGGGAATTTTCCCCAACATC
SULT1B1 GGTTATCCCATGACCTGTGC/CCAGGGAGAGTCATTTCCAA