Skip to main content

Table 1 Primers used in qRT-PCR

From: New STAT3-FOXL2 pathway and its function in cancer cells

Primer name Sequences (5′-3′)
hTRAIL-F GCGCAGCGAGTGGGACAGAG
hTRAIL-R GGCACTGGGTCCGTGCTGTC
hTNF-F CCAAATGGGGGAGTGAGAGG
hTNF-R AAAGGCAAAGACCAAAGAAAATGA
hFas-F TGAAGGACATGGCTTAGAAGTG
hFas-R GGTGCAAGGGTCACAGTGTT
hGnRHR-F ACCGCTCCCTGGCTATCAC
hGnRHR-R GACTGTCCGACTTTGCTGTTGCT
hGAPDH-F GAGTCAACGGATTTGGTCGT
hGAPDH-R GACAAGCTTCCCGTTCTCAG