Skip to main content

Advertisement

Table 1 Sequences of Cited2-shRNA and the primers

From: Cited2 regulates proliferation and survival in young and old mouse cardiac stem cells

Primer Forward primer 5′ → 3′ Reverse primer 5′ → 3′
Cited2 (for dd PCR and RT-PCR) AAATCGCAAAGACGGAAGGA TGAACTGGGAGTTGTTAAACCT
Cited2-shRNA1 TGGCAGACCATATGATGGCCATGAA  
Cited2-shRNA2 CCCACAACCACTACATGCCGGATTT  
Cited2-shRNA3 GTCAGCTGTTGACTCGGTTAA  
Cited2-cDNA tatcgaattc(EcoRI)ATGGCAGACCATATGATGGCCATGAAC tatcggatcc(BamHI)ACAGCTGACTCTGCTGGGCTGCT
GAPDH GCTGCCCAGAACATCATCCCT TGAAGTCGCAGGAGACAACC