Skip to main content

Table 1 Forward (forw) and reverse (rev) primer sequences for cloning of wild type enzymes (wt) and for site-directed mutagenesis (substitution of Asp by Ala at position 422, D422A) of DNA polymerase I large fragments

From: Characterization and engineering of a DNA polymerase reveals a single amino-acid substitution in the fingers subdomain to increase strand-displacement activity of A-family prokaryotic DNA polymerases

Primer Sequence (5′ to 3′ direction)
Psychrobacillus sp.
 PB_wt_forw CACCACAGAAGTAGCATTCGAGATTGTT
 PB_wt_rev TTACTTCGTGTCATACCAAGATGAACC
Geoacillus stearothermophilus
 Gbst_wt_forw ACCATCATGGATCCGGCGCCAAAATGGCATTTACCCT
 Gbst_wt_rev CATCCGCCAAAACAGCCTTATTTGGCATCATACCAGG
 Gbst_D422A_forw GTGTATGGCATCAGCGCTTATGGTCTGGCACAG
 Gbst_D422A_rev CTGTGCCAGACCATAAGCGCTGATGCCATACAC
Ureibacillus thermosphaericus
 Ureibac_wt_forw ACCATCATGGATCCGGCGCAGCACTGAGCTTTAAAAT
 Ureibac_wt_rev CATCCGCCAAAACAGCCTTATTTGGCATCGTACCAGG
 Ureibac_D422A_forw CTATGGCATCAGCGCTTATGGTCTGAGCC
 Ureibac_D422A_rev GGCTCAGACCATAAGCGCTGATGCCATAG