Skip to main content

Table 2 List of primer sets for PCR analysis

From: Functional analyses of miRNA-146b-5p during myogenic proliferation and differentiation in chicken myoblasts

GeneForwardReverseAnnealing Temp. (°C)PCR size(bp)
ActinGATGATATTGCTGCGCTCGTGTGCTCCTCAGGGGCTACTC60 °C618
Pax7AGGTACCAAGAGACGGGCTCCTCGGCAGTGAAAGTGGTCC60 °C411
MyoDACACGTCGGACATGCACTTCTCTGACTCCCCGCTGTAGTG55 °C433
SMAD4GCCCACCACAACATACTCCTGCACTTGAGATCGAAGGCGT60 °C315
NUMBGCTGCCCCAACTACTACTGCACAGGGCACTAATGCTGTCC55 °C310
ADCK3CTGTGCAGCAAACATGTCCTGGCATCTTCCATTTCCTTGA60 °C366
RRM2BGGACCTTCCTCACTGGAACATCCACTTCAGAGCCCAGTCT55 °C308
SGCBCACGAGTTTCATCTGCCAAATCACTTGCACCTTGAACAGC55 °C343
CCND3TTTCTGGATGCTGGAGGTGTATGCAGAGCTTCTCCACAGT60 °C195
IRF2AATGCAGAGGGACGACTTCAACTGGGTGATGTCTGACGTT60 °C301
WNT5AGATACCGCTTTGCCAAGGAGGCCTACCTTGCGGAAATCAG60 °C224
PDGFRBAGAGCTAGAGGACAGTGGGACATTGGAAGCTCGGATGGTG60 °C359
CCNB2TGAAATGTTGGTGGTAGGGCGGAACAAGTATGCAAGTAGC60 °C209
CDC20GAGTCCTGAACCTGACCATGCTGTACAGTGTGTAAGCCCA60 °C221
KIF23CCTTTCTTGTCAGGCCCTCTTCTGTGAGCACGTTACCCTT60 °C348
KPNA2ACACAGAGCAAGGGGTTACATCCAAATTCAGGGCAATGCT60 °C332
PLK1CTGATGCTGTGGTGATGGTGTCTCAACCTGGGCACGTTAA60 °C316
TOP2ATCAACAAAGGCAGCAAGGTCGGCTCGATTCATCCTGGAGA60 °C348
ID1TGATCGACTACATCTGGGACCTCTGAGAAGGTTACGAGCCG60 °C251
sno RNA: GGGATGTAAAAAAATACTTGCTATC
miR-146b: UGAGAACUGAAUUCCAUAGGCG
60 °C