Skip to main content

Table 2 List of primer sets for PCR analysis

From: Functional analyses of miRNA-146b-5p during myogenic proliferation and differentiation in chicken myoblasts

Gene

Forward

Reverse

Annealing Temp. (°C)

PCR size(bp)

Actin

GATGATATTGCTGCGCTCGT

GTGCTCCTCAGGGGCTACTC

60 °C

618

Pax7

AGGTACCAAGAGACGGGCTC

CTCGGCAGTGAAAGTGGTCC

60 °C

411

MyoD

ACACGTCGGACATGCACTTC

TCTGACTCCCCGCTGTAGTG

55 °C

433

SMAD4

GCCCACCACAACATACTCCT

GCACTTGAGATCGAAGGCGT

60 °C

315

NUMB

GCTGCCCCAACTACTACTGC

ACAGGGCACTAATGCTGTCC

55 °C

310

ADCK3

CTGTGCAGCAAACATGTCCT

GGCATCTTCCATTTCCTTGA

60 °C

366

RRM2B

GGACCTTCCTCACTGGAACA

TCCACTTCAGAGCCCAGTCT

55 °C

308

SGCB

CACGAGTTTCATCTGCCAAA

TCACTTGCACCTTGAACAGC

55 °C

343

CCND3

TTTCTGGATGCTGGAGGTGT

ATGCAGAGCTTCTCCACAGT

60 °C

195

IRF2

AATGCAGAGGGACGACTTCA

ACTGGGTGATGTCTGACGTT

60 °C

301

WNT5A

GATACCGCTTTGCCAAGGAG

GCCTACCTTGCGGAAATCAG

60 °C

224

PDGFRB

AGAGCTAGAGGACAGTGGGA

CATTGGAAGCTCGGATGGTG

60 °C

359

CCNB2

TGAAATGTTGGTGGTAGGGC

GGAACAAGTATGCAAGTAGC

60 °C

209

CDC20

GAGTCCTGAACCTGACCATG

CTGTACAGTGTGTAAGCCCA

60 °C

221

KIF23

CCTTTCTTGTCAGGCCCTCT

TCTGTGAGCACGTTACCCTT

60 °C

348

KPNA2

ACACAGAGCAAGGGGTTACA

TCCAAATTCAGGGCAATGCT

60 °C

332

PLK1

CTGATGCTGTGGTGATGGTG

TCTCAACCTGGGCACGTTAA

60 °C

316

TOP2A

TCAACAAAGGCAGCAAGGTC

GGCTCGATTCATCCTGGAGA

60 °C

348

ID1

TGATCGACTACATCTGGGACC

TCTGAGAAGGTTACGAGCCG

60 °C

251

sno RNA: GGGATGTAAAAAAATACTTGCTATC

miR-146b: UGAGAACUGAAUUCCAUAGGCG

60 °C