Skip to main content

Table 2 Sequence of primers used for real-time quantitative PCR and ChIP-PCR

From: Klotho is regulated by transcription factor Sp1 in renal tubular epithelial cells

Name Forward Primer Reverse Primer Size bp
Klotho GCCCACATACTGGATGGTATCAA ACTGCACTCAGTACACACGGTGA  
β-Actin ATCTGGCACCACACCTTC AGCCAGGTCCAGACGCA
IVS TTACCAAACGAGAAGCATTACA CAAAGGGAAGAGGGGACAAG 118
KLP CTTCTTTGGGCCTCCGAGTG CGACCAACTTTCCCCGACTT 108