Skip to main content

Table 1 Primers and probes for digital RT-PCR

From: A fast, efficient and high-throughput procedure involving laser microdissection and RT droplet digital PCR for tissue-specific expression profiling of rice roots

Tissue Position Gene Primer name Oligo sequence Amplicon size Probe name Probe sequence Tm probe Fluorophore Reference
All LOC_Os01g70380 Serine palmitoyltransferase Serine_F TTGCCGTCGATAATCCTGAC 196 pSerine CCTCGTTCGTTCGTCGCTGACGGC 64.2 HEX Sato et al. 2013 [15]
Serine_R GAGGAAGAGGTCGTCAATGG  
  TFIIE (LOC_Os10g25770) Transcription factor 2E TFIIE_F TTAGCTGTGTTGGTCATGGG 161 pTFIIE CGGAAGAGCTGCTTCAGGTCATCGTCG 63 HEX This work
TFIIE_R TCCCAGGAGGACATTGTGTA  
  EXP’ (LOC_Os07g02340) Expressed Exp_F ATGGGCAGAAGTCGAAGATG 155 pExp AGCCAGCTTGAGGCCAACAAGAAGGCC 64.9 HEX This work
Exp_R TTTGCACTTGGTCTCAGAGG      
Stele LOC_Os08g44750 Nodulin-like protein 5NG4_F GCAGATATGGTGCATCGACA 170 p5NG4 GCCTCCCTCACCCTCGGCGAGAGC 66.4 FAM Sato et al. 2013 [15]
5NG4_R CCCAGAGGACGAGGTAGAG  
  OsSHR1 (LOC_Os07g39820) SHR1 SHR1_F CAAGCCGCCTCCG 79 pSHR1 CGTCCTACAACTCGAGG 70 HEX Henry et al. 2017 [16]
SHR1_R TGGACCCGCTCGAC  
Cortex LOC_Os10g18820 Plant disease response protein Dis_F AAGGGATCCACACTTCAGGT 152 pDis GCTGCAAGCAGTGGTGAGTGGTCTGTT 63.2 FAM Sato et al. 2013 [15]
Dis_R AGTTCTCGAACAGCATCCTC  
  LOC_Os06g48950 OsARF19 OsARR19_F TCCTCAGACTCAGAACACCA 177 pARF19 TGCCTGGGCTGAGCTTGGTTCAGTGG 64.6 FAM Yamauchi et al. 2019 [17]; Takehisa et al. 2012 [1]
OsARR19_R GGTTCTGCAGGCATAATTGC   
  LOC_Os01g60960 OsLBD1–8 OsLBD1–8_F CGTCCAAGTCCATATCACCG 198 pLBD1–8 CTTCGCCGCTCCTCCTCCTCCTCC 66.4 FAM Yamauchi et al. 2019 [17]
OsLBD1–8_R TTGAGGGAGCTGTAGTCAGT   
Outer LOC_Os10g39890 Pollen Ole 1 allergen Ole_F TTCTACTTCACCCTGTCCCA 179 pOle GGACGGTGCCACCTACTGATCGACCGT 65.2 FAM Sato et al. 2013 [15]
Ole_R ACAAAGGCCAAACAACACAC  
  LOC_Os02g06290 OsHAC4 OsHAC4_F GGAAGGAGAAGAACCCACAC 188 pHAC4 AGGTGTGCGATCCAGGCTCGCGA 64.5 FAM Xu et al. 2017 [18]
OsHAC4_R CTGGCTTTCACTTCGGAGAA   
  LOC_Os06g44970 OsPIN2 OsPIN2_F CCAGAGCGTCATCTGGTACA 80 pPIN2 CCCTCATGCTCTTCCTCTTCG 63.6 FAM Wang et al. 2018 [19]
OsPIN2_R GGAACTGCTCGGAGATGAG