Skip to main content

Table 2 Primer sequences and amplicon sizes for each gene analysed in the study

From: Novel leukocyte-depleted platelet-rich plasma-based skin equivalent as an in vitro model of chronic wounds: a preliminary study

Gene Forward Primer (5′-3′) Reverse Primer (5′-3′) Fragment size
CD34 TGAAGCCTAGCCTGTCAC ATAAGACCTCCAGCTGTGCG 180 bp
CD45 GTGTTTCATCAGTACAGACG GCTGTCATTTCAACCACAAC 191 bp
CD73 ATGGTGTGGAAGGACTGATC CATCGCTCAGAAAGTGAGG 310 bp
CD90 TGCTCTTTGGCACTGTGG CTGCTCCTGCTCTCCCTCT 248 bp
CD105 GGGGTCAACACCACAGAG CACATCCTGAGGGTCCTG 261 bp
IL8 GAGAGTGATTGAGAGTGGACCAC AAACTGGGTGCAGAGGGTTGTG 90 bp
TGFA GGTCCGAAAACACTGTGAGTGG AAGAGCCCAGAGGAGGAGTTTG 108 bp
ACTB AGTCCTAGCTACTCCGGAGGC CGGCTATTCTCGCAGCTCAC 113 bp