Skip to main content

Table 1 List of primers for amplification and characterization

From: Construction and characterization of EGFP reporter plasmid harboring putative human RAX promoter for in vitro monitoring of retinal progenitor cells identity

Putative Promoter regions /Genes Primers Sequences (5′ > 3′)
OCT4 Sense
Anti-sense
TCTATTTGGGAAGGTATTCAGC ATTGTTGTCAGCTTCCTCCA
NANOG Sense
Anti-sense
CAGCTACAAACAGGTGAAGAC TGGTGGTAGGAAGAGTAAAGG
NESTIN Sense
Anti-sense
TCCAGGAACGGAAAATCAAG TTCTCTTGTCCCGCAGACTT
SIX3 Sense
Anti-sense
TCCTCCTCTTCCTTCTCC GTTGTTGATAGTTTGCGGTT
RAX Sense
Anti-sense
CAACTGGCTACTGTCTGTC CTTATTCCATCTTTCCCACCT
PAX6 Sense
Anti-sense
CAGCTCGGTGGTGTCTTTG AGTCGCTACTCTCGGTTTA
RAX-267 Sense ATTAATAGAGAAGGGGCTGGGT
RAX-525 Sense ATTAATTAGTCTGAAGTGAGAGG
RAX-1665 Sense
Anti-sense
GTCGACGAATTAATCAGAGGTGG
AGATCTCTTTGGAGACGGAGAGG
RAX-2761 Anti-sense AGATCTCTCCCCTTGCGTTTGT
RAX-3007 Anti-sense AGATCTACCCAGCCCCTTCTC
RAX-3258 Sense
Anti-sense
GTCGACGAATTAATCAGAGGTG AGATCTCTTTGGAGACGGAGAGG