Skip to main content

Table 1 Primer sequences

From: Induction of iPSC-derived Prg4-positive cells with characteristics of superficial zone chondrocytes and fibroblast-like synovial cells

Primer sequence Forward (5’-3’) Reverse (5’-3’)
Actb GCTACAGCTTCACCACCACA CTTCTGCATCCTGTCAGCAA
Nanog TTCCTGGTCCCCACAGTTTG CTGGGCCTGAGAGAACACAG
Oct3/4 TCCCATGCATTCAAACTGAG CCACCCCTGTTGTGCTTTTA
Esrrb CAAGAGAACCATTCAAGGCAACA CATCCCCACTTTGAGGCATTT
Rex1 TTGGAGGAAGTGGAGCAAAACC TTCTCTTGCTTCGTCCCCTTTG
Gapdh TGACCTCAACTACATGGTCTACA CCGTGAGTGGAGTCATACTGG
Prg4 AGCCAATGAAGAAGTGCACAGGGA AGGTGTGTGTCTGGAAAGGTCCAA
TenascinC TGGGATTGGTTCTGCTGTCAA CATTTCTTCCGTGGATGCCTTCAC
Erg CCAGCGTCCTCAGTTAGATCCTTACCA TCATGTTGGGCTTGCTCTTCCTCTC
Runx1 AACCCTCAGCCTCAGAGTCA GCGATGGATCCCAGGTACT
Wnt16 GCCACTACCACTTCCACCC GAGCCACCATTCTGCAAGG
Wnt9a GGTGGGCAAGCACCTAAAAC GTACAAGCTCTGGTGTTCGGG
Cadherin11 CAATATCGTTGATGGAGACGGC ACATTGGCGGCCTCTATCTT
Col4a CGCCTGGTACAAAAACCTCCA CCGTGATAAAGTGCGTGCCA
Cd55 AATGCGAGGGGAAAGTGAC TGAGGGGGTTCCTGTACTTG
Vcam1 GGAGACCTGTCACTGTCAACTG TCCATTTCACCACTGTGTAACC
Icam1 AGACACAAGCAAGAAGACCACA TGACCAGTAGAGAAACCCTCG
Cd248 GCCAGCAGATGTGTGTCAA GTAGGTGCCAGCCATAGGAT