Skip to main content

Table 2 Sequence of PCR primers

From: Functional neural differentiation of human adipose tissue-derived stem cells using bFGF and forskolin

Gene Sense Antisense
Lipoprotein lipase CTTCTGTTCTAGGGAGAAAGTG TGCTGTGTAGATGAGTCTGATT
Osteopontin GAAGGACAGTTATGAAACGAGT AACATAGACATAACCCTGAAGC
PTH receptor AACTACTACTGGATTCCTGGTGG CTCCAAGATTTCTTGATCTCAG
Periecan CATAGAGACCGTCACAGCAAG ATGAACACCACACTGACAACC
Collagen type II ACGGCGAGAAGGGAGAAGTTG GGGGGTCCAGGGTTGCCATTG
ABCG2 CAAAACTTGCTGGGTAATC ACAGAAACCACACTCTGACC
Nestin CTCTGACCTGTCAGAAGAAT GACGATGACACTTACAGAAT
Tuj1 CATGGATGCCGCTCAG CAGGCAGTCGCAGTTTTCAC
MAP2 TGCCATCTTGGTGCCGA CTTGACATTACCACCTCCAGGT
NFL TCCTACTACACCAGCCATGT TCCCCAGCACCTTCAACTTT
NFM TGGGAAATGGCTCGTCATTT CTTACTGGAAGCGGCCAATT
NSE CTGATGCTGGAGTTGGATGG CCATTGATCACGTTGAAGGC
GAP43 TCCTGAGCCCTGTCTCTCCCT GCCACACTGTTTGACTTGGG
SNAP25 AGTTGGCTGATGAGTCGCTG TGAAAAGGCCACAGCATTTC
GFAP GCAGAGATGATGGAGCTCAATGACC GTTTCATCCTGGAGCTTCTGCCTCA
CNPase GGCCACGCTGCTAGAGTGCAAGAC GGTACTGGTACTGGTCGGCCATTT
MaxiK ACAACATCTCCCCCAACC TCATCACCTTCTTTCCAATTC
Kv1.4 ACGAGGGCTTTGTGAGAGAA CACGATGAAGAAGGGGTCAT
Kv4.2 ACCGTGACCCAGACATCTTC CACTGTTTCCACCACATTCG
Kv4.3 GCCTCCGAACTAGGCTTTCT CCCTGCGTTTATCAGCTCTC
EAG1 TGGATTTTGCAAGCTGTCTG GAGTCTTTGGTGCCTCTTGC
EAG2 ACATCCTGCTTTTCGATTGG CGGCTCTCTACCTGGCGTTG
NE-Na GCTCCGAGTCTTCAAGTTGG GGTTGTTTGCATCAGGGTCT
SCN5A CCTAATCATCTTCCGCATCC TGTTCATCTCTCTGTCCTCATC
CACNA1C AACATCAACAACGCCAACAA AGGGCAGGACTGTCTTCTGA
CACNA1G CTGCCACTTAGAGCCAGTCC TCTGAGTCAGGCATTTCACG
GAPDH CATGACCACAGTCCATGCCATCACT TGAGGTCCACCACCCTGTTGCTGTA