Skip to main content

Table 1 Gene names and its primers.

From: Adiponectin and AMP kinase activator stimulate proliferation, differentiation, and mineralization of osteoblastic MC3T3-E1 cells

Gene name Primers Accession no.
mAdipoR1 CTTCTACTGCTCCCCACAGC NM_028320
  TCCCAGGAACACTCCTGCTC  
mAdipoR2 CCACACAACACAAGAATCCG XM_132831
  CCCTTCTTCTTGGGAGAATGG  
mCypB TCGGAGCGCAATATGAAGGT BC013061
  TTCTTCTTATCGTTGGCCACG  
mCol-I AACCCGAGGTATGCTTGATCT NM_007742
  CCAGTTCTTCATTGCATTGC  
mOCN TGCTTGTGACGAGCTATCAG L24431
  GAGGACAGGGAGGATCAAGT  
mRunx-2 AAGTGCGGTGCAAACTTTCT NM_009820
  TCTCGGTGGCTGGTAGTGA  
mOsterix CCCTTCTCAAGCACCAATGG AF184902
  AGGGTGGGTAGTCATTTGCATAG  
m36B4 AAGCGCGTCCTGGCATTGTCT NM_007475
  CCGCAGGGGCAGCAGTGGT  
HPRT CAGTCCCAGCGTCGTGATTA J00423
  AGCAAGTCTTTCAGTCCTGTC  
  1. Primer pairs used for studying various genes.
  2. m; mouse, AdipoR; adiponectin receptor, CypB; cyclophilin B, Col-I; collagen type I, OCN; osteocalcin, HPRT; hypoxanthine phosphoribosyltransferase.
  3. 36B4 and HPRT are housekeeping genes.
\