Skip to main content

Table 2 Primers used

From: Protease 3C of hepatitis A virus induces vacuolization of lysosomal/endosomal organelles and caspase-independent cell death

Primer Sequence*
Bi3Cf GCAGAAGATATC GCCACCATGTCAACTCTAGAAATAGCAGGA
Bi3Cr CACTTTGCTAGCTTACTGACTTTCAATTTTCTTATC
Bi3Cm-f GGTCTTCCCGGGATGGCTGGTGGGGCCCTAGTG
Bi3Cm-r CACTAGGGCCCCACCAGCCATCCCGGGAAGACC
rt-3Cf GGTTCAGTTTGGAGTTGGTGA
rt-3Cr TTCCTCTCCATGCCTGATCT
rt-GAPDHf GGTCGTATTGGGCGCCTGGTCACC
rt-GAPDHr CACACCCATGACGAACATGGGGGC
  1. *Restriction sites are boldfaced, Kozak sequence is italic, sequence corresponding to Cys172 → Ala mutation is boldfaced and italized. All primers were from Evrogen (Russia).