Skip to main content

Table 2 Primers sequences and conditions of PCR

From: Dexamethasone in osteogenic medium strongly induces adipocyte differentiation of mouse bone marrow stromal cells and increases osteoblast differentiation

Gene Primer sequences Annealing temperature Product length Genbank
Runx2 F: GCCGGGAATGATGAGAACTA 62°C 200 bp NM_001146038.2
R: GGACCGTCCACTGTCACTTT
OC F: AAGCAGGAGGGCAATAAGGT 60°C 364 bp NM_007541.3
R: CGTTTGTAGGCGGTCTTCA
OSX F: CTAGTTCCTATGCTCCGACC 54°C 237 bp NM_130458.1
R: TCATCACATCATCATCGTG
ALP F:CAAAGGCTTCTTCTTGCTGGT 60°C 257 bp NM_007431.3
R: AAGGGCTTCTTGTCCGTGTC
PPAR gamma −2 F: GGTGAAACTCTGGGAGATTCT 55°C 268 bp NM_011146.3
R: CAACCATTGGGTCAGCTCTTG
Leptin F: CTCATGCCAGCACTCAAAAA 62°C 197 bp NM_008493.3
R: AGCACCACAAAACCTGATCC
Glut4 F: ACTCTTGCCACACAGGCTCT 62°C 174 bp NM_009204.2
R: AATGGAGACTGATGCGCTCT
Adiponectin F: CCCAGTCATGCCGAAGA 62°C 354 bp NM_009605.4
R: TACATTGGGAACAGTGACGC
GAPDH F: GGCATTGCTCTCAATGACAA 62°C 200 bp NM_008084.1
R: TGTGAGGGAGATGCTCAGTG
18S F: ATTCCGATAACGAACGAGAC 60°C 297 bp NR_003278.3
R: GCTTATGACCCGCACTTACT
Cyclin D1 F: CGCACTTTCTTTCCAGAGTCA 55°C 74 bp NM_007631.2
R: AAGGGCTTCAATCTGTTCCTG
Cyclin E1 F: TCAACGACACGGGTGAG 55°C 196 bp NM_007633.2
R: ATGTCGCACCACTGATAACCT
Cyclin B1 F: CGCTCAGGGTCACTAGG 54°C 159 bp NM_172301.3
R: CTTCGCTGACTTTATTACCAA