Skip to main content

Table 2 Oligonucleotide sequences for enzymatic assay substrates. [FAM]: derivative of the fluorophore Fluorescein, attached to position 5 of the thymidine ring; Dabcyl: N-[4-(4-dimethylamino)phenylazo] benzoic acid, dark quencher (non-fluorescent chromophore) attached to position 5 of the thymidine ring; Flc: Fluorescein, fluorophore attached to position 5 of the thymidine ring; [BHQ2]: Black Hole Quencher 2, dark quencher (non-fluorescent chromophore) – attached to the 5′ end via a phosphodiester bond; [TAMRA]: Carboxytetramethylrhodamine, attached to the 3′ end via a phosphodiester linkage

From: Characterization and engineering of a DNA polymerase reveals a single amino-acid substitution in the fingers subdomain to increase strand-displacement activity of A-family prokaryotic DNA polymerases

Oligonucleotide Sequence (5′ to 3′ direction)
Single-nucleotide incorporation assay
 Template ATTGAGTGGAGATAGTATCGTAGGGTAGTATTGGTGGATA
 Primer [FAM] TATCCACCAATACTACCCT
Polymerase activity assay
 Template GGCCCGTDabcylAGGAGGAAAGGACATCTTCTAGCATFlcACGGGCCGTCAAGTTCATGGCCAGTCAAGTCGTCAGAAATTTCGCACCAC
 Primer GTGGTGCGAAATTTCTGAC
Strand-displacement activity assay
 Template [BHQ2]ATTGAGTGGACAAAGTATCGTAGGGTAGTATTGGTGGATA
 Reporter strand CGATACTTTGTCCACTCAAT [TAMRA]
  “Cold” primer TATCCACCAATACTACCCT