Construction of strains to identify novel factors for regulation of centromeric cohesion protection (CCP) and sister kinetochore mono-orientation (SKM)

Table 1 List of primers used in this study

Primer name	Sequence	Remark
GM105	atgcatgcatgcatgcctcgagatggcacccagaaaacgc	Forward primer with XhoI restriction site for SPO13 amplification
GM106	atgcatgcatgcatgcgctagcttaattaagggaagactcactatc	Reverse primer with NheI restriction site for SPO13 amplification
MA113	atgcatgcatgcatgcgaattcatggcacctctttcgttg	Forward primer with EcoRI restriction site for REC8 amplification
APB004	ggactagtaaggcatatacaattatttcg	Reverse primer with SpeI restriction site for REC8 amplification
MA111	atgcatgcatgcatgcgaattcatgagggaaaaaagaacaat	Forward primer with EcoRI restriction site for MAM1 amplification
APB003	ggactagtaaattttcatctatatgtagcttt	Reverse primer with SpeI restriction site for MAM1 amplification
MA72	atgcatgcatgcatgcctcgagatgtcgttgggtcctcttaa	Forward primer with XhoI restriction site for CDC5 amplification
MA73	atgcatgcatgcatgcgctagcttaatctacggtaacaat	Reverse primer with NheI restriction site for CDC5 amplification
APB008	ataagaatgcggccgcaactgttgggaagggcgatc	Forward primer with NotI restriction site anneal at ADH1 terminator
APB009	cccaagcttatacgcaaaccgcctctccccgc	Reverse primer with HindIII restriction site anneal at CYC1 terminator

ISSN: 2661-8850