Skip to main content

Advertisement

Table 1 List of primers used in this study

From: Construction of strains to identify novel factors for regulation of centromeric cohesion protection (CCP) and sister kinetochore mono-orientation (SKM)

Primer name Sequence Remark
GM105 atgcatgcatgcatgcctcgagatggcacccagaaaacgc Forward primer with XhoI restriction site for SPO13 amplification 
GM106 atgcatgcatgcatgcgctagcttaattaagggaagactcactatc Reverse primer with NheI restriction site for SPO13 amplification
MA113 atgcatgcatgcatgcgaattcatggcacctctttcgttg Forward primer with EcoRI restriction site for REC8 amplification
APB004 ggactagtaaggcatatacaattatttcg Reverse primer with SpeI restriction site for REC8 amplification
MA111 atgcatgcatgcatgcgaattcatgagggaaaaaagaacaat Forward primer with EcoRI restriction site for MAM1 amplification
APB003 ggactagtaaattttcatctatatgtagcttt Reverse primer with SpeI restriction site for MAM1 amplification 
MA72 atgcatgcatgcatgcctcgagatgtcgttgggtcctcttaa  Forward primer with XhoI restriction site for CDC5 amplification
MA73 atgcatgcatgcatgcgctagcttaatctacggtaacaat Reverse primer with NheI restriction site for CDC5 amplification
APB008 ataagaatgcggccgcaactgttgggaagggcgatc Forward primer with NotI restriction site anneal at ADH1 terminator
APB009 cccaagcttatacgcaaaccgcctctccccgc Reverse primer with HindIII restriction site anneal at CYC1 terminator