Skip to main content

Table 1 Primers sequences for RT-PCR and Q-PCR analysis

From: Effects of high glucose conditions on the expansion and differentiation capabilities of mesenchymal stromal cells derived from rat endosteal niche

Gene Primer Sequence Length (bp) Application
p53 F: ACAGCGTGGTGGTACCGTAT
R: GGAGCTGTTGCACATGTACT
83 Q-PCR
p21waf1 F: TCTTGCACTCTGGTGTCTCA
R: GGGCTTTCTCTTGCAGAAG
147 Q-PCR
p16INK4A F: TGCAGATAGACTAGCCAGGGC
R: CTCGCAGTTCGAATCTGCAC
184 Q-PCR
GAPDH F: GCAAGAGAGAGGCCCTCAG
R: TGTGAGGGAGATGCTCAGTG
74 Q-PCR
rTERT F: GCTCCGGTTACACAGCAGCCCCTGGCA
R: GGTCCAGAGCACGCACACGCAGCACGA
752 RT-PCR
TR F: CTCCGCCCGCTGTTTTTCTCGCTGACT
R: GCCACCGAACTCAGGGACCAGTTCCGT
300 RT-PCR
CD73 F: TCCCGCGGCTGCTACGGCACCCAAGTG
R: ACCTTGGTGAAGAGCCGGGCCACGCCG
204 RT-PCR
CD90 F: CCTGACCCGAGAGAAGAA
R: TGAAGTTGGCTAGAGTAAGGA
125 RT-PCR
CD105 F: CGGTCTCCAGCTGCGGTGGTGGGCTCC
R: CACTGCCACCACGGGCTCCCGCTTGCT
896 RT-PCR
CD34 F: GTCACACTGCCTACTACTTC
R:TCCTCGGATTCCTGAACAT
210 RT-PCR
CD45 F: AGCAATACCAGTTCCTCTATGA
R: TCCGTCCACTTCGTTATGA
113 RT-PCR
CD106 F: TCCACACTGACGCTGAGCCCTGTGGGTG
R: CTCCGGCATCCTGCAGCTGTGCCTTGCG
898 RT-PCR
CD146 F: GCAGCGCCACGGGTGTGCCAGGAGAGG
R: CCCCACTGTGGTGCTTCTGGGCGGGCT
900 RT-PCR
Nanog F: GGGGATTCCTCGCCGATGCCTGCCGTT
R: GGGATACTCCACCGGCGCTGAGCCCTT
477 RT-PCR
Oct4 F: GCCCACCTTCCCCATGGCTGGACACCT
R: GCAGGGCCTCGAAGCGGCAGATGGTTG
563 RT-PCR
Slug F: CACTCCCCTCTGCCCAGCGGCCTTTCT
R: GGCATGGGGGTCTGAAAGCTTGGGCTG
171 RT-PCR
Snail F: GCGAGCTGCAGGACGCGTGTGTGGAGT
R: CGGCAAAGGCACGGTTGCAGTGGGAGC
597 RT-PCR
β-actin F: TGAAGATCAAGATCATTGCTCCTCC
R: CTAGAAGCATTTGCGGTGGACGATG
155 RT-PCR
Osterix F: GCTTTTCTGTGGCAAGAGGTTC
R: CTGATGTTTGCTCAAGTGGTCG
136 Q-PCR
OCN F: AAGCCCAGCGACTCTGAGTCT
R: CCGGAGTCTATTCACCACCTTACT
75 Q-PCR
Adiponectin F: GAATCATTATGACGGCAGCAC
R: CTTGGAGCCAGACTTGGTCTC
224 Q-PCR
PPARγ F: GGAAGCCCTTTGGTGACTTTATGG
R: GCAGCAGGTTGTCTTGGATGTC
174 Q-PCR
β-actin F: TGAAGATCAAGATCATTGCTCCTCC
R:CTAGAAGCATTTGCGGTGGACGATG
108 Q-PCR