Skip to main content

Advertisement

Table 1 Primers used for quantitative real-time PCR

From: Evaluation of PAX8 expression promotes the proliferation of stomach Cancer cells

GenePrimers (5′ to 3′, forward/reverse)
SOX13CCAGAGGGTAATGGGTCCC / TGGCTTCCATAGAGTTCCTTCC
PAX8ATCCGGCCTGGAGTGATAGG / TGGCGTTTGTAGTCCCCAATC
Aurora BCAGAAGAGCTGCACATTTGACG / CCTTGAGCCCTAAGAGCAGATTT
Cyclin B1ACGAAGGTCTGCGCGTGTT / CCGCTGGCCATGAACTACCT
GAPDHGGAGCGAGATCCCTCCAAAAT / GGCTGTTGTCATACTTCTCATGG
PAX8 promoteGAACAGAGGGAATGGCTTC/CCAGAAGTGAGAGGGATGGT