Skip to main content

Table 1 Primers used for quantitative real-time PCR

From: RETRACTED ARTICLE: Evaluation of PAX8 expression promotes the proliferation of stomach Cancer cells

Gene Primers (5′ to 3′, forward/reverse)
SOX13 CCAGAGGGTAATGGGTCCC / TGGCTTCCATAGAGTTCCTTCC
PAX8 ATCCGGCCTGGAGTGATAGG / TGGCGTTTGTAGTCCCCAATC
Aurora B CAGAAGAGCTGCACATTTGACG / CCTTGAGCCCTAAGAGCAGATTT
Cyclin B1 ACGAAGGTCTGCGCGTGTT / CCGCTGGCCATGAACTACCT
GAPDH GGAGCGAGATCCCTCCAAAAT / GGCTGTTGTCATACTTCTCATGG
PAX8 promote GAACAGAGGGAATGGCTTC/CCAGAAGTGAGAGGGATGGT