Skip to main content

Table 2 Primer sequences for qRT-PCR

From: EphB4/ TNFR2/ERK/MAPK signaling pathway comprises a signaling axis to mediate the positive effect of TNF-α on osteogenic differentiation

GeneForward (5′ ~ 3′)Reverse (5′ ~ 3′)
Runx2CCCAGCCACCTTTACCTACATATGGAGTGCTGCTGGTCTG
BspCAGGGAGGCAGTGACTCTTCAGTGTGGAAAGTGTGGCGTT
Ephb4GCGGAAAGCAACAAAGTACGGCAGCGTACAGCATAAGT
Tnfr2CTGCGCCTTGAAAACCCATTGATGCTACAGATGCGGTGGG
GapdhAGGTCGGTGTGAACGGATTTGTGTAGACCATGTAGTTGAGGTCA