Skip to main content

Table 1 The primer sequences

From: Uncarboxylated osteocalcin alleviates the inhibitory effect of high glucose on osteogenic differentiation of mouse bone marrow–derived mesenchymal stem cells by regulating TP63

Gene Primer sequences(5′ → 3′) Accession Number
RUNX2 F: GCCGGGAATGATGAGAACTA
R: GGACCGTCCACTGTCACTTT
NM_001146038.2
OSX F: CTAGTTCCTATGCTCCGACC
R: TCATCACATCATCATCGTG
NM_130458.1
ALP F: CAAAGGCTTCTTCTTGCTGGT
R: AAGGGCTTCTTGTCCGTGTC
NM_130458.1
FAS F: TGCTTGCTGGCTCACAGTTAAGAG
R: TCAGGTTGGCATGGTTGACAGC
NM_007988.3
Ap2 F: AAGTGGGAGTGGGCTTTG
R: GTCGTCTGCGGTGATTTC
NM_024406.3
TP63 F: CTGGAAAACAATGCCCAGAC
R: GAGGAGCCGTTCTGAATCTG
NM_001127262.1
GAPDH F: ACCCAGAAGACTGTGGATGG
R: CACATTGGGGGTAGGAACAC
NM_130458.1