Skip to main content

Table 1 Primer sequences used in this study to measure specific gene expression

From: Influence of mechanical and TGF-β3 stimulation on the tenogenic differentiation of tonsil-derived mesenchymal stem cells

Primer Forward 5′-3′ Sequence Reverse 5′-3′ Sequence
18 s rRNA GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG
SCX ACAGATCTGCACCTTCTGCC GCCACCTCCTAACTGCGAAT
TNMD TCCCTCAGGCTCTGGTATGA AGGACTGAGAGACCACTGCT
DCN TGCCAAAGGATCTTCCCCCT AGGTGTAAATGCTCCAGGACT
COL1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC
COL3 TGGAGGATGGTTGCACGAAA ACAGCCTTGCGTGTTCGATA
TNC ATGGGCAGACGCACCATTAG TGTGCATCGACCTTCACAAGA
OCN TCCTTTGGGGTTTGGCCTAC CCAGCCTCCAGCACTGTTTA
RUNX2 CCTACCTGAGCCAGATGACG ATGCTGGGTGGCCTGAAAT
COL2 GCTCCTGCCGTTTCGCTG ATTATACCTCTGCCCATCCTGC
SOX9 AGGAAGTCGGTGAAGAACGG AAGTCGATAGGGGGCTGTCT