Isolation and culture of rat hepatic stellate cells
All animal protocols were in full compliance with the guidelines for animal care and were approved by the Animal Care Committee from the government. Adult male Sprague-Dawley rats (Harlan Winkelmann GmbH, Borchen, Germany), which had free access to altromin chow (Altromin GmbH, Lage, Germany) and water were anaesthetized with an intramuscular injection of 100 mg/kg body weight ketaminhydrochloride (Ketavet®; SANOFI-CEVA GmbH, Düsseldorf, Germany) and 7 mg/kg body weight xylazinhydrochloride (Rompun®; BayerVital, Leverkusen, Germany). rHSCs were isolated by the pronase-collagenase method, a two-step method for preparation of rat liver cells comprising a first step in which the liver is pre-perfused with a Ca2+-free medium in order to remove intercellular Ca2+, and a second step in which the liver is perfused with a Ca2+ requiring collagenase mixture [32, 33, 34]. Briefly, livers were perfused at 10 ml/minute with 200 ml Hanks balanced salt solution (HBSS) without Ca2+and Mg2+ (PAA Laboratories GmbH, Linz, Austria), 100 ml solution E [0.35% (w/v) pronase E in HBSS with Ca2+ and Mg2+] followed by recirculating perfusion for approximately 30 minutes with 60 ml solution F [0.015% (w/v) collagenase in HBSS with Ca2+ and Mg2+]. Thereafter, livers were dissected under permanent pH control (pH 7.3) in 100 ml HBSS with Ca2+ and Mg2+ containing 10 mg DNase, type II (Roche, Mannheim, Germany). The cell suspension was subsequently filtered through nylon mesh (250 μm and 100 μm) and centrifuged for 7 minutes at 450 × g at 4°C. The resulting pellet was washed in ice cold solution G containing 0.25% (w/v) bovine serum albumin in HBSS/+Ca2+/+Mg2+. rHSCs were purified by single-step density gradient centrifugation with 8.25% (w/v) Nycodenz® (Nycomed Pharma AS, Oslo, Norway) as described in detail elsewhere [33]. rHSCs were carefully collected by aspiration of the white top layer of the gradient. The purity of cell preparations was assessed by light microscopic appearance, vitamin A autofluorescence of the cells and positive immunofluorescence stainings [35]. rMFBs were prepared by subculturing primary rHSCs by trypsinization at day 7 after seeding following spontaneous activation on the plastic surface. rHSCs and rMFBs were cultured in Dulbecco's modified Eagle medium (DMEM; BioWhittaker Europe, Verviers, Belgium) containing 4 mM L-glutamine and 10% fetal calf serum (Seromed, Biochrom KG, Berlin, Germany). Additionally, all culture media were supplemented with penicillin (100 IU/ml) and streptomycin (100 μg/ml), respectively. All cultures were maintained at 37°C and 5% CO2 in a humidified atmosphere.
The murine fibroblast cell line NIH/3T3 [36] was purchased from the American Type Culture Collection (Rockville, MD) and maintained in culture at 37°C in DMEM supplemented with 10% fetal calf serum, 4 mM L-glutamine, penicillin (100 IU/ml) and streptomycin (100 μg/ml). All transfections of NIH/3T3 cells with various transfection agents were performed at approximately 60% confluency.
Transfection of hepatic stellate cells
The reporter construct pEGFP-C1 (GenBank Accession number U55763) was purchased from CLONTECH (Palo Alto, CA). rHSCs were transfected two days after seeding, rMFBs cells two days after subculturing (see above) with 2 μg plasmid DNA. The DNA was isolated by a standard alkaline extraction method or a cesium chloride gradient purification protocol. Transfections were performed with the commercially available cationic liposome reagents Effectene (Qiagen, Hilden, Germany), LipofectAmine Plus (Gibco Life Technologies, Karlsruhe, Germany), Superfect (Qiagen), the lipid-based reagent FUGENE™6 (Roche), and a classical calciumphosphate based method (Promega, Madison, WI) with and without glycerol shock, following essentially the instructions of the manufacturers. For glycerol shock the medium was removed, cells were rinsed in HBSS/-Ca2+/-Mg2+ three times and overlayed with 15% glyerol in HBSS/-Ca2+/-Mg2+for 2 minutes at 37°C. Thereafter, glycerol solution was removed and cells were washed three times with HBSS/-Ca2+/-Mg2+prior addition of regular growth medium. Transfection efficiencies were monitored 48 hours later by fluorescence microscopy and flow cytometry analysis.
Microscopic data documentation
Microscopic images shown are from representative experiments. For visual observation of transfected and infected cells expressing EGFP, we typically used a 40 × objective lens and a 10 × eyepiece lens. Documentation of representative eye fields had been performed with a HV-C20 digital camera (HITACHI Denshi Ltd., Tokyo, Japan) and the DISKUS software package version 4.14 (Hilgers, Königswinter, Germany).
Flow Cytometry
Flow cytometric measurements were performed immediately after collection of cultured cells. Cells were trypsinized under standard conditions and washed once with HBSS/-Ca2+/-Mg2+. To get informations about viability, collected cells were additionally stained with propidium iodide (PI) (Sigma, Deisenhofen, Germany). Fluorescence signals were recorded with a flow cytometer FACS-Calibur (Becton Dickinson, Sparks, MD) using a 488 nm excitation and a 530 ± 30 nm emission fluorescence filter for EGFP and a 630 ± 11 nm emission fluorescence filter for PI, respectively. Data were acquired and analyzed with the CellQuest™ software version 3.1 (Becton Dickinson).
Construction of replication-defective recombinant adenoviruses
Plasmids pΔE1sp1A [19] and pJM17 [20] for construction of adenoviral vector were obtained from Microbix Biosystems Inc. (Toronto, Ontario, Canada). For construction the adenoviral reporter shuttle vector pΔE1sp1A-CMV-EGFP the 1656-bp Asn I/Ssp I fragment from plasmid pEGFP-C1 was filled in by Klenow DNA polymerase and cloned into the Eco RI digested and Klenow filled in pΔE1sp1A. The orientation of the CMV-EGFP expression cassette in pΔE1sp1A-CMV-EGFP and the integrity of cloning boundaries were verified by restriction analysis and sequencing with flanking primers 5'-d(GCGTAACCGAGTAAGAATTTG)-3' and 5'-d(GGCGACCATCAATGCTGGAG)-3', respectively. Primers were obtained from MWG- Biotech AG (Ebersberg, Germany) and sequence reactions were done with the ABI PRISM BigDye® termination reaction kit (PE Applied Biosystems, Weiterstadt, Germany). Integration of vector sequences from pΔE1sp1A-CMV-EGFP into adenoviral backbone vector pJM17 for production of replication-deficient virus particles were performed by in vitro homologous recombination in the human embryo kidney cell line 293, which constitutively express the E1 gene products required for propagation of recombinant adenoviruses [21]. Briefly, approximately 5 × 105 293 cells were seeded in six-well dishes and cotransfected with 2 μg of plasmid pΔE1sp1A-CMV-EGFP, 2 μg pJM17 and 10 μl of the FuGENE™6 reagent. After 16 hours at 37°C, the media containing the transfection mix was removed, and 2 ml of growth medium was added and cells were cultured for 10-12 days with subsequent addition of fresh medium. Generation of recombinant viral particles were visualized by increase of EGFP-positive cells and by viral foci formation in fluorescence microscopy. After total infection viral particles were released from cells by three rounds of a freeze-thaw cycle. Viral particles were separated from cell debris by centrifugation at 3000 rpm for 10 minutes. To generate higher titer viral stocks, 293 cells were re-infected at a multiplicity of infection (MOI) of 1 and grown for 3-4 days, at which time viruses were harvested as described above.
Adenoviral infection
Viral stock solutions were titered on 293 cells in growth medium containing 10% fetal calf serum following standard procedures [37] and kept frozen at -20°C until use. For infection of rHSCs/rMFBs with adenoviral particles 105 cells were seeded in six-well dishes with 2 ml medium and cells were infected 2 days later with 500 μl viral stock containing approximately 10 6 plaque forming units of Ad5-CMV-EGFP.
RNA isolation and Northern analysis
Cells from human cell line 293 and murine cell line NIH/3T3 were rinsed with ice cold HBSS/-Ca2+/-Mg2+, and then lysed in 1 ml per 106 cells of lysis buffer containing 25 mM sodium acetate pH 6.0, 4 M guanidine thiocyanate and 0.835% (v/v) β-mercaptoethanol. The lysate was adjusted to 8 ml with lysis buffer, pressed three times through a 20-g needle, layered onto a 4-ml cushion of a solution containing 25 mM sodium acetate pH 6.0 and 5.7 M cesium chloride, and then centrifuged for approximately 24 h at 21°C and 25000 rpm in a Beckman SW41-type rotor. RNA pellets were resuspended in 300 mM sodium acetate (pH 6.0), ethanol precipitated and resuspended in water. The concentration of RNA was determined by absorbance at 260 nm.
For Northern analysis, 30 μg of total cellular RNAs were separated by electrophoresis in a 1.2% (w/v) denaturing agarose gel, transferred to a Hybond-N membrane (Amersham Pharmacia Biotech, Freiburg, Germany) and fixed by baking for 2 h at 80°C. Blots were pre-hybridized for at least 3 h, and then hybridized for 16 h at 37°C to [α-32P]dCTP-labelled probes (Multiprime DNA labelling system; Amersham) in a buffer containing 50% (v/v) formamide, 6 × SSC, 5 × Denhardt's solution [0.1% (w/v) Ficoll 400, 0.1% (w/v) BSA, 0.1% polyvinylpyrrolidone], 5 mM EDTA, 0.5% (w/v) SDS, and 100 μg/ml sheared denatured herring sperm DNA (Roche). Filters were washed once at 55°C for 20 minutes in a solution containing 2 × SSC, 1 mM EDTA, and 0.1% (w/v) SDS, then twice at 50°C for 20 minutes in a solution containing 0.4 × SSC, 1 mM EDTA, and 0.1% (w/v) SDS. Autoradiographs were exposed for indicated times to Kodak X-OMAT AR films at -80°C using intensifying screens. As an internal standard (loading control) the blots were re-hybridized with a GAPDH specific cDNA.
