Skip to main content

Table 1 Primers sequences

From: Responsiveness of human bronchial fibroblasts and epithelial cells from asthmatic and non-asthmatic donors to the transforming growth factor-β1 in epithelial-mesenchymal trophic unit model

GENE SEQUENCE
ACTA2 F′ CTGTTCCAGCCATCCTTCAT R’ CCGTGATCTCCTTCTGCATT
DNAH9 F′ GAGTCTTCCCAGCCACTCTTAC R’ ATTCTGCATTCTCCAGAGCTTC
GAPDH F′ GAAGGTGAAGGTCGGAGT R’ GAAGATGGTGATGGGATTTC
MUC5A F′ TTCCATGCCCGGGTACCTG R’ CAGGCTCAGTGTCACGCTCTT
CDH2 F′ CTCCATGTGCCGGATAGC R’ CGATTTCACCAGAAGCCTCTAC
P63 F′ CCCGTTTCGTCAGAACACAC R’ CATAAGTCTCACGGCCCCTC
SNAI1 F′ GCTGCAGGACTCTAATCCAGA R’ ATCTCCGGAGGTGGGATG
SNAI2 F′ TGGTTGCTTCAAGGACACAT R’ GTTGCAGTGAGGGCAAGAA
FN1 F′ TGTGGTTGCCTTGCACGAT R’ GCTTGTGGGTGTGACCTGAGT
TAGLN F′ CGTGGAGATCCCAACTGGTT R’ AAGGCCAATGACATGCTTTCC
TNC F′ GGTCCACACCTGGGCATTT R’ TTGCTGAATCAAACAACAAAACAGA
18S F′ GTAACCCGTTGAACCCCAT R’ CCATCCAATCGGTAGTAGCG