Protein Ser/Thr phosphatase-6 is required for maintenance of E-cadherin at adherens junctions

Protein phosphatase-6 in human epithelial cells

Protein phosphatase-6 catalytic subunit (PP6c) expression is highest in the gastrointestinal tract and in hematopoietic cells, based on tissue analyses of mRNA and protein in GeneAtlas (biogps.org) and ProteinAtlas (proteinatlas.org). We stained sections of normal human colon with hematoxylin and eosin (H&E, Figure 1A) and for PP6c by immunohistochemistry (Figure 1B). There was intense PP6c staining in the epithelial cells, seen as a continuous layer of cells surrounding the large unstained granules of mucosal fluid (that are blue by H&E). Staining for PP6c in the surrounding mesenchymal cells (red by H&E) was much weaker. A few scattered cells that stained intensely for PP6c we suspect were infiltrating lymphocytes. To study PP6 in human epithelial cells we chose Caco-2 cells, which have been well characterized over the years as a model for the intestinal epithelium [12].

Caco-2 cells were seeded so as to reach confluence within days of culture and cells were fixed and stained for PP6c at various times. Laser-scanning confocal microscopy showed immunofluorescent localization of the endogenous PP6c initially in the perinuclear region, and subsequently as predominantly cytosolic, with little or no staining in the nuclei (Figure 2B, C). These observations are consistent with previous reports of PP6c being predominantly cytosolic [13, 14]. The first days after replating PP6c immunostaining of individual cells appeared at either high or low intensities. Areas with higher density cells, where nuclei were closer together (e.g. top third of Figure 2B) showed higher intensity PP6c compared to areas with lower density cells (lower half of Figure 2B). When cultures became confluent (Figure 2C) the PP6c was distributed uniformly throughout the cells, and we noted the staining intensity was higher than on previous days.

The increase in PP6c was confirmed by quantitative immunoblotting of cells harvested at various times after re-plating (Figure 2D). The results demonstrated that relative levels of PP6c protein dramatically increased (~8-fold) between 3 and 7 days, when cells reached 100% confluence, and these higher levels more than doubled again over the next two weeks (days 14–28). By comparison levels of the PP6-specific regulatory subunits PP6R1 and PP6R3, the dominant endogenous partners for PP6c, did not increase over the first two weeks and showed only slightly increased levels after 3 to 4 weeks of culture (Figure 2D), indicating their expression was not co-dependent with PP6c. There was a step-wise increase in the amount of PP6R2 (two bands that are presumably different spliced forms, commonly seen) at 7 days after the cells had reached confluence and this level persisted for 28 days (Figure 2D). Thus, the pattern of PP6c expression was different from any of its regulatory subunits. Actin was used as a loading control to insure the same amount of total cell protein was analyzed on the immunoblots (Figure 2D, bottom panel). These observations support the hypothesis that the PP6c was accumulating in cells without a corresponding increase in one of its canonical SAPS partners.

The multi-fold increase in PP6c protein levels was unexpected and unusual for a Ser/Thr phosphatase. By comparison, there was no detectable change over the entire time course, up to 28 days, in the levels of the closely related phosphatase PP2A catalytic subunit (PP2Ac) or its specific scaffolding subunit (PP2A-A) (Figure 2D). This shows the cell density changes in expression levels were not common among PPP phosphatases. Previous studies have shown that PP2A is under stringent feedback control, keeping the protein levels within a relatively narrow range [15, 16]. Levels of α4, the atypical subunit that binds to all type 2A phosphatases (PP2A, PP4 and PP6) also did not change when Caco-2 cells formed confluent monolayers. Because neither α4 nor PP2A levels changed we concluded it was unlikely that α4 was involved in the increase in PP6.

We also examined cell-density dependent increase of PP6c expression in human ARPE-19 pigmented retinal epithelial cells. Different number of cells (2.5, 5, 10 and 15 × 10⁴ cells) were seeded in 6 well plates and cultured for 4 days at which time they were at 40-50%, 80-90%, 90-100% confluent and 100% post-confluent, respectively. The PP6c content of ARPE-19 cells increased with cell density and was much higher in near-confluent and post-confluent cells (Figure 2E). These results showed different human epithelial cell lines exhibit cell density-dependent increase in expression of the catalytic subunit of PP6.

Enhanced PP6c expression in high-density epithelial cells

We examined what might contribute to the elevated PP6c protein levels in high density cells. The increase was due at least in part to elevation of the steady-state levels of PP6c mRNA. We used quantitative real-time PCR to compare PP6c mRNA in Caco-2 cells plated at different densities and found that high density cells had significantly (p<0.05) more PP6c mRNA compared to low density cells (Figure 3A). Levels of PP6c also can be controlled by at least two miRNA, miR31 and miR373, and changes in these miRNA and the levels of PP6c have been linked to different types of cancer [17, 18]. Our assays showed there was a significant increase in both miR31 and miR373 in high density vs. low density cells (Figure 3B, C). These results run counter to expectations, because an increase in levels of miRNA targeting PP6c would be predicted to reduce, not increase, protein production. We concluded that miR31 and miR373 are not the dominant factors controlling PP6c levels in Caco-2 cells.

The increase in PP6c mRNA levels in high density cells corresponded to increased transcription of the PP6c gene. We cloned the 1500 nucleotides upstream of the transcriptional start site and used this as a proximal promoter for expression of firefly luciferase. A dual luciferase system was used to assay for activity of the PP6 promoter. Activity of firefly luciferase was normalized to Renilla luciferase expressed from a separate plasmid that was co-transfected into cells. Transcription driven by the PP6c promoter was nearly doubled in cells plated at high density vs. low density, a statistically significant difference (p<0.001; Figure 3D). The relative increase in transcription corresponded to the increase in the mRNA levels we observed, but do not seem to adequately account for the 15 to 20-fold increase in protein levels.

To test for a change in protein degradation we added cycloheximide to inhibit translation in high density Caco-2 cells and observed that levels of both PP6c and PP2Ac proteins were only slightly reduced after 1, 2, or 3 days (Figure 3E). In contrast, as a positive control, the levels of cyclin D1 in these cells were fully depleted within the first 24 hr (Figure 3E). Thus, there seemed to be a limited amount of PP6c degradation in high density cells. The low levels of PP6c protein made it difficult to observe degradation in low density cells. We concluded that an increase in transcription, elevated levels of mRNA, and a low rate of protein degradation probably accounted for the accumulation of PP6c protein in high density epithelial cells.

Association of PP6c with E-cadherin

In high density Caco-2 cells we observed concentration of endogenous PP6c along the cell-cell boundaries by immunofluorescent confocal scanning microscopy (Figure 4A, B, green). We used double immunostaining to examine whether PP6 was localized to adherens junctions or tight junctions in different optical sections. PP6 co-localized (yellow in merged image) in the same Z plane section with E-cadherin (red), a marker of adherens junctions (Figure 4A). On the other hand, PP6 did not overlap or co-localize with occludin (red), a tight junction protein (Figure 4B). The results revealed specific localization of PP6 at adherens junctions.

The localization of PP6c at adherens junctions prompted us to test for association of PP6c with E-cadherin by co-immunoprecipitation of the endogenous proteins in Caco-2 cells. First, we separated cytosolic and membrane fractions by sucrose gradient centrifugation and analyzed protein distribution by immunoblotting (Figure 4C). Effective separation of membranes from cytosol was demonstrated by GAPDH as a cytosolic marker and beta-integrin as a membrane marker. The majority of E-cadherin, β-catenin and α-catenin were recovered in the membrane fraction, as expected. Conversely, phosphatases PP6c and PP2Ac were predominantly in the cytosol, with limited amounts recovered in the membrane fraction (Figure 4C). Immunoprecipitation with anti-PP6c antibody compared to a non-specific IgG as negative control demonstrated selective recovery of PP6c from either the cytosol or membrane fractions (Figure 4D, lanes 2 and 4, bottom panel). From the membrane fraction, but not from the cytosol, there was specific co-precipitation of PP6c with E-cadherin, as well as α-catenin and β-catenin (Figure 4D). Furthermore, in a reciprocal immunoprecipitation, anti-E-cadherin antibody co-precipitated PP6c from the membrane fraction, compared to non-specific IgG as a negative control to show specificity (Figure 4E). None of the canonical PP6 subunits PP6R1, R2 or R3 were detected in the immunoprecipitates (Figure 4E). We concluded that endogenous PP6 forms stable complexes with E-cadherin/catenin in the adherens junctions of Caco-2 epithelial cells. The regulatory subunits of PP6 were not detected by immunoblotting in the E-cadherin complexes prepared by immunoprecipitation from membranes. This supported the idea that PP6c associated with E-cadherin without participation of the SAPS subunits.

To test for direct protein-protein interaction between PP6c and E-cadherin, we used a pull-down assay with purified S-tagged PP6c on beads mixed with the cytosolic domain of E-cadherin (Figure 2F). The S-tag PP6c was expressed in 293T cells, and recovered on S-protein beads that were washed with 2 M urea, which was sufficient to leave only the S-tag PP6c on the beads, based on silver staining after SDS-PAGE (not shown). The E-cadherin cytosolic domain was detected as a single ³⁵S-radiolabeled protein produced by in vitro transcription and translation. Using essentially identical amounts of ³⁵S-E-cadherin cytosolic domain in the assays we observed some non-specific binding to control S-protein beads, but considerably more binding with S-tag PP6c on the beads (Figure 4F). The results provide evidence for a direct protein-protein interaction between PP6c and the cytoplasmic tail of E-cadherin.

PP6 is required for maintenance of E-cadherin at adherens junctions

Testing whether PP6 affects E-cadherin function or localization at adherens junctions poses experimental challenges. There are no pharmacological inhibitors specific for PP6 relative to other PPP phosphatases, and we found knockdown of PP6c in epithelial cells by siRNA transfection prevented formation of confluent monolayers. As an alternative approach we generated lentiviruses using TRIPZ vectors, with doxycycline (dox) inducible expression of shRNA targeting PP6c. Inducible knockdown of PP6c in confluent Caco-2 cells disrupted E-cadherin and β-catenin localization at adherens junctions, but did not alter localization of either tight junction protein occludin or ZO-1 (Figure 5A), demonstrating that the actions of PP6c are highly localized and specific. The endogenous E-cadherin was removed from the cell-cell junctions into a juxtamembrane region and also was dispersed throughout the cytosol. Treatment of the cells with casein kinase-1 (CK1) inhibitor IC-261 prevented this relocalization of E-cadherin in response to knockdown of PP6c (Figure 5B). The rescue of the PP6c knock down phenotype by inhibition of CK1 is consistent with the idea that these enzymes were opposing one another.

To analyze the redistribution of E-cadherin we performed line scanning densitometry perpendicular to the margins of cell-cell junctions. The fluorescent intensity of immunostaining for endogenous E-cadherin was quantified along this axis (Figure 5C), fitted to a Gaussian curve and scored for the full width at half maximum height (FWHM) (Figure 5D). Experiments were independently replicated and as many as 20 individual scans collectively analyzed to show a statistically significant (p<0.001) increase in peak width due to PP6c knockdown, and this was rescued to control levels by addition of IC-261 (Figure 5D). Immunoblotting showed dox induced shRNA-mediated knock down of endogenous PP6c, without a change in the levels of PP2A or E-cadherin (Figure 5E). We concluded that PP6c was required for maintenance of E-cadherin at adherens junctions, and this likely involved reversing CK1 phosphorylation, probably a site in the cytoplasmic tail of E-cadherin.

Substitution of Ser846 prevents effects of PP6c knockdown on E-cadherin localization

Residue Ser846 in murine E-cadherin (human residue S844) has been established as a substrate for CK1, and phosphorylation at this site shown to be critical for internalization of E-cadherin off the cell surface [10]. We examined the localization of epitope-tagged wild type (WT) and a S846A mutant of murine E-cadherin in Caco-2 cells. We observed that knockdown of PP6c dispersed WT E-cadherin from its plasma membrane localization, mimicking the effects on endogenous E-cadherin (Figure 6A). Line scans across cell-cell junctions (Figure 6B) visualized in the fluorescent microscopic images (Figure 6A) were fitted to Gaussian curves and analyzed for FWHM (Figure 6C). Statistical analyses of dozens of scans showed a significant (p< 0.01) 2-fold increase in FWHM of WT E-cadherin due to PP6c knockdown (Figure 6C). The behavior of this tagged version of E-cadherin mimicked the behavior of the endogenous protein (compare Figures 5A and 6A). On the other hand, the S846A mutant of E-cadherin was resistant to effects of PP6c knockdown (Figure 6C). These data support the conclusion that PP6c-dependent dephosphorylation of this Ser residue promotes surface localization of E-cadherin in adherens junctions.

Cell culture, antibodies and immunoblotting

Caco-2 cells were grown in DMEM containing 10% FBS, 1x non-essential amino acid (Sigma), 1 mM sodium pyruvate (Sigma) and 1x anti-biotic/anti-mycotic (Invitrogen). ARPE19 cells were obtained from ATCC and were grown according to ATCC recommendations.

Antibodies were obtained from the indicated suppliers: rabbit PP6R2, PP6R3 (Bethyl), goat PP2A-A subunit (Santa Cruz), β-actin (Sigma), rabbit E-cadherin (Cell Signaling), mouse E-cadherin, α-catenin, β-catenin (BD Bioscience), species specific secondary antibodies IR 680 (Invitrogen), IR800 (LI-COR), Alexa 488 and Alexa 568 (Molecular Probes). Chicken antibodies for PP6c and PP6R1 and rabbit α-4 antibody were generated as previously described [13, 24]. Mouse anti-PP2Ac monoclonal antibody was provided by Marc Mumby. Cells were lysed in a buffer containing 50 mM Tris–HCl (pH 8.0), 1 mM EDTA, 0.2% SDS, 0.5% Nonidet P-40, 1 mM Na₃VO₄, 1 μM Microcystin-LR, and Roche Complete protease inhibitor mixture. The proteins were separated by SDS-PAGE and transferred onto nitrocellulose membrane (Bio-Rad). The membranes were blocked with 3% skim milk and treated with antibodies as described and quantified by Odyssey infrared scanner and software (Licor Inds.).

Quantitative RT-PCR

Total RNA from Caco-2 cells (0.1 μg) was reverse transcribed in a final incubation volume of 20 μl using a ThermoScript kit (Invitrogen) at 37°C for 1 h. The resulting first-strand cDNA was subjected to quantitative PCR using the SYBR green detection system (Bio-Rad). The sequences of primers of PP6c and GAPDH were adopted from RTPrimerDB primer database (ID: 8029 and 3 respectively). PP6c expression was normalized to an endogenous GAPDH control. The relative quantitative value for PP6c compared with GAPDH was expressed as comparative Ct (2^–(ΔCt-Cc)) method.

Luciferase assays of PP6 promoter

The 1500 nt immediately upstream of the PP6 transcription start site on human chromosome 9 was subcloned into pGL3basic. Caco2 cells (4 × 10⁶) were co-transfected in suspension for 3 h using Lipofectamine 2000 (Invitrogen) with 10:1 ratio of reporter plasmids [pGL3basic hPP6-report] (12 ug) and phRL-CMV (Promega) (1.2 ug). Following transfection, cells were plated in triplicate onto 12 well dishes at high density (1 × 10⁶ cells/well) and low density (2 × 10⁵ cells/well). At 72 h following transfection, cells were lysed with the passive lysis buffer (Promega) and luciferase activities were measured with a Berthold LB 953 luminometer using a firefly luciferase assay kit (Biotium). Renilla luciferase activity was measured with 0.09 μM coelenterazine (Biosynth) in 25 mM Tris, pH 7.5, 100 mM NaCl in all samples to normalize for transfection efficiency.

Isolation and analysis of membrane and cytosolic fractions

Caco-2 cells were suspended in MOPS buffer (50 mM MOPS-NaOH (pH 7.4), 125 mM NaCl, 1 mM EGTA, 0.1% 2-mercaptoethanol, and Roche Complete protease inhibitor) and homogenized by glass pestle homogenizer. Homogenates were centrifuged (100,000 g) for 20 min and the supernatant used as the cytosolic fraction. Pellets were resuspended with MOPS buffer and applied on top of 28% sucrose layered on 50% sucrose. After 40 min centrifugation (100,000 g), the 28/50% interface was collected and washed with MOPS buffer by centrifugation. The resulting pellets were solubilized in MOPS buffer containing 1% Nonidet P-40 and after 15 min centrifugation (16,000 g), the supernatant was used as the membrane fraction. Antibodies were bound to protein G-agarose beads and covalently cross-linked by dimethyl pimelimidate treatment (Harlow and Lane [25]). Cytosolic and membrane fractions of Caco-2 cells were incubated with antibody-coupled beads. Normal IgG coupled to beads was used as control.

In vitro PP6 binding assay

Binding assay was performed by incubating S-tag PP6c on S protein agarose beads with in vitro translated ³⁵S labeled Flag E-cadherin C-terminal segment. Human PP6c mRNA sequence was inserted into pTriEX4 vector. pTriEX4 PP6c or pTriEX4 empty vectors were transfected into HEK293T cells and cultured for 2 days. Cells were lysed with MOPS buffer (50 mM MOPS-NaOH (pH 7.4), 125 mM NaCl, 1 mM EGTA, 0.1% 2-mercaptoethanol, and Roche Complete protease inhibitor) containing 1% Nonidet P-40. S-tag PP6c was pulled down by S-protein agarose (Novagen) at 4°C for 4 h. Precipitates were washed to remove associated proteins with 2 M Urea/MOPS buffer twice, with 1 mM ATP/1mM MgCl₂/MOPS buffer once, and then with MOPS buffer once. pGEX5X-1 Rat E-cadherin cytosolic fragment was provided by Dr. Barry M. Gumbiner and subcloned into pcDNA3 Flag vector. For in vitro transcription and translation, TNT T7 coupled Reticulocyte Lysate System (Promega) was used with 35S methionine. Empty pcDNA3 Flag vector was used as a control. After 2 h at 4°C beads were washed with MOPS buffer and binding proteins were separated by SDS-PAGE and S35 bands visualized with a Phosphor-Imager (Molecular Dynamics).

Virus production and PP6c knockdown

Short hairpin RNA (shRNA) targeting PP6c (5' CCAGAACGACAACGCCATATT 3’) was inserted into TRIPZ vector (Open Biosystems). Lentivirus for expressing of PP6c shRNA and non-coding shRNA were packaged by co-transfecting plasmids of lenti-vector, psPAX2 and VSV-G into HEK293 cells (Addgene). The virus-containing medium was collected at 48–72 hrs. Adenovirus was prepared using the system developed by He et al. [26]. Briefly, the fragment containing the shRNA, inducible tetracycline responsive RNA Polymerase II promoter and turboRFP was excised and inserted in the shuttle vector, pAdTrack. The resulting plasmids were cotransfected with the adenoviral backbone plasmid, pAdEasy-1, into BJ5183 bacteria. Recombined plasmid was selected and transfected into HEK 293 cells to generate virus, which was amplified and then purified by CsCl gradient ultracentrifugation to create a high titer viral stock. Viruses encoding the inducible expression region and turboRFP from TRIPZ vector were used as a control.

Caco-2 cells were cultured to 80% confluence and infected with control shRNA or PP6C shRNA virus. Approximately 6–8 hours post-transduction, media was replaced containing doxycycline at a concentration of 1 μg/ml. After inducing expression for 4 days, the cells were treated without or with IC261 (10 μM) for 4 h and then fixed for fluorescent microscopy.

Co-expression of myc-E-cadherin and shRNA

The AgeI restriction site in the TRIPZ vector containing the non-coding shRNA and PP6c shRNA was used to ligate blunt-ended fragments encoding mouse E-cadherin wild type (WT) and S846A tagged with myc epitope. Lentiviruses were produced by transfecting TRIPZ vector, psPAX2 and pCMV-VSVG in HEK293-LT cells and virus-containing media were collected at day 2 and 3. Caco-2 cells were infected with lentivirus and selected with 5 μg/ml puromycin. Cells with stable expression were induced by doxycycline (1 μg/ml) when they were confluent. After inducing expression for 4 days cells were fixed by methanol/acetone (1:1) for immunofluorescence staining.

Immunofluorescent microscopy

Caco-2 cells were fixed by methanol/acetone (1:1) and permeabilized with 0.5% Triton X-100 for 20 min. The specimens were blocked with 10% goat serum for 1 hr at room temperature. The primary antibodies (E-cadherin from BD Biosciences 1:200, occludin from BD Biosciences 1:400, ZO-1 from Upstate 1:200, β-catenin from BD Biosciences 1:200 and c-myc from Santa Cruz 1:200) were incubated at 4°C for overnight. Secondary anti-rabbit or anti-mouse antibodies were conjugated with Alexa fluor-488 or 647 (Invitrogen). The immunofluorescent images were captured by Leica SP5 X White Light confocal microscope. Fluorescence intensity was measured by line scanning with software in the Leica application suite. Results of line scan were plotted with Gaussian fit and Gaussian full width at half maximum (FWHM) was calculated.

Statistical analysis

The results are expressed as the means ± S.E. Comparisons between groups were performed by one-way ANOVA, followed by Student-Newman-Keuls test. For all of the analyses, a probability value of p<0.05 was considered as statistically significant.