Cell culture
Human PC cell line DU145 along with the human embryonic kidneys (HEK293T) which were purchased from the National Institute of Genetic Engineering and Biotechnology cell bank (NIGEB Tehran, Iran) were considered for in vitro examinations. We used Roswell Park Memorial Institute (RPMI1640, Invitrogen, USA) and Dulbecco’s Modified Eagle Medium (DMEM, Gibco, USA) for culturing DU145 and HEK293T cells, respectively. Each media was supplemented with 100,000 U/L of penicillin, 100 μg/ml streptomycin (Fluka, Switzerland), and 10% fetal bovine serum (FBS, Biowest, France). Cells incubation was carried out in a humidified 5% CO2 incubator at 37 °C (Binder, USA).
Vector construct and transfection
Human sFLT01 coding Sequence [21] was synthesized and His Tag sequence was added to the end of the construct with PCR reaction (primer sequences: 5′- GAATTCATGGTCAGCTACTG − 3′ (Forward), and 5′- GGATCCTCAGTGGTGGTGGTGGTGGTGTTTACCCGGAGACAGGGAG − 3′ (Reverse)). PCR product was cloned into pJET1.2/blunt plasmid (Thermo Fisher Scientific, Canada). The thermocycler was programmed as follows; 95 °C for 5 min denaturation step, and 35 cycles consisted of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 2 min following an additional 72 °C for 5 min, final extension step with Pfu DNA Polymerase (Agilent, USA).
PCR product was inserted into a pJET1.2/blunt plasmid (Thermo Fisher Scientific, Canada) and cloned in Escherichia coli XL10 bacteria (Agilent, USA) using the heat-shocked method [11]. After bacterial proliferation, the pJET-sFLT01-HisTag plasmids were extracted with the Plasmid Extraction Kit (SinaClon Co, Iran) according to the company protocol. After recovering the sFLT01-HisTag fragment from the gel, the fragment of interest was inserted into the pAAV-MCS-GFP vector (Agilent, USA) through a ligation protocol, and then the resulted plasmids were transformed into the host bacterial cells. Eventually, pAAV-sFLT01-HisTag-GFP plasmids were purified then analyzed with the gel electrophoresis method and sequences were determined.
Human PC cell line DU145 was considered as the host for transfection of pAAV-sFLT01-HisTag-GFP and pAAV-MCS-GFP vectors. 4 × 106 cells seeded into each well of the six-well plates. Transfection was mediated by using the Lipofectamine 2000 reagent (Invitrogen, USA) according to the manufacturer’s guidelines. In brief, 5 μg of DNA sample was mixed with 525 μl of the antibiotic-free culture medium and added to a mixture of 21 μl lipofectamine 2000 reagent in 502 μl of culture medium. Following 20 min incubation at room temperature, the transfection mixture was gently dropped on the cells, admixed, and kept for 6 h at 37 °C under 5% CO2. After replacing the culturing medium, cells were incubated for the next 72 h.
RNA isolation and real-time PCR analysis
Total RNA was isolated from DU145 treated and control cultures (DU145 cells transfected by pAAV-sFLT01-HisTag-GFP or control vector, pAAV-MCS-GFP) using the TriPure Isolation Reagent (Roche, Germany), according to the manufacturer’s protocol. The RNA samples were subsequently treated with 1 μg DNase I enzyme (Accurate genomic DNA removal kit, ABMgood, Canada) for 1 h and quantified with an ND-1000 Nanodrop (Nanodrop Technologies, USA).
1 μg of total RNA was applied for cDNA synthesis by the QuantiTect Reverse Transcription Kit (Qiagen Inc., USA). Real time-PCR was carried out on a 7500 Real-Time PCR System (Applied Biosystems, USA) with the QuantiFast SYBR Green PCR Kit (Qiagen Inc., USA). The thermocycler was programmed as follows; a 95 °C for 3 min denaturation step, and 40 cycles consisted of 95 °C for 10 s and 60 °C for 30 s. The expression level of sFLT01 was normalized to GAPDH as an endogenous control and the expression level of interested genes was calculated by using the 2-∆∆CT method based on the threshold cycle (Ct) values. Each sample was assessed in duplicate at least. The primer sequences were as follows: sFLT01 Forward 5′-AGGAAGGGAGCTCGTCATTC-3′ and Reverse 5′-GCCCATTGACTGTTGCTTCA-3′, GRP78 Forward 5′- CGTGGAGATCATCGCCAAC-3′ and Reverse 5′-ACATAGGACGGCGTGATGC-3′, MMP2 Forward 5′-TTGATGGCATCGCTCAGATC-3′ and Reverse 5′-TTGTCACGTGGCGTCACAGT-3′, MMP9 Forward 5′- GTGATTGACGACGCCTTT − 3′ and Reverse 5′- CAACTCGTCATCGTCG-3′, TIMP1 Forward 5′- CTTCTGGCATCCTGTTGT-3′ and Reverse 5′- ACTGCAGGTAGTGATGTG-3′, TIMP2 Forward 5′-AAGCGGTCAGTGAGAAGGAAG-3′ and Reverse 5′- GGGGCCGTGTAGATAAACTCTAT-3′, and GAPDH Forward 5′-ACAGTCAGCCGCATCTTC-3′ and Reverse 5′- CTCCGACCTTCACCTTCC-3′.
Purification and evaluation of sFLT01 protein
To determine the sFLT01 protein concentration in transfected HEK293T cells. Culture medium was collected 72 h after transfection and centrifuged for 10 min at 500×g to remove the bulk of cell debris. His-tagged sFLT01 protein was purified using the nickel affinity chromatography (Ni–NTA agarose beads, ABT, Spain), according to the company protocols. Next, SDS-PAGE and Western blotting techniques were applied to determine the level of sFLT01 protein using 1:50000 human VEGFR1/Flt-1 primary antibody and a 1:100000 goat IgG HRP-conjugated secondary antibody (R&D Systems, USA). Blots were developed with using ECL select™ Western blotting detection reagent (GE Healthcare, Amersham™,Buckinghamshire HP7 9NA UK) and a specific band was visualized.
Cellular viability assay (MTT)
Viability of cell cultures was determined by the MTT colorimetric assay (Sigma-Aldrich, USA). A total of 6.6 × 103 DU145 cells/well were seeded into each well of a 96-well plate and incubated with 100 μl media containing RPMI1640 and DU145 cells conditioned medium in a ratio of 2:1 (DU145 cells transfected by pAAV-sFLT01-HisTag-GFP or control pAAV-MCS-GFP transfected DU145 cells), for 48 h at 37 °C under 5% CO2. Then, each well-received 20 μl of MTT (0.5 mg/ml in PBS, pH 7.2) and cultures were kept for the next 4 h. After removing the solution, cells were treated with 200 μl of dimethyl sulfoxide (DMSO, Sigma-Aldrich, USA) for 5 min. The number of viable cells was assessed using an ELx800 absorbance microplate reader (Bio-Rad, USA), at a wavelength of 580 nm.
Tube formation assay
Tube formation assay was performed to determine the ability of sFLT01 to inhibit tube formation in the human umbilical vein endothelial cells (HUVECs). The 96-well plates were coated with growth factor-reduced Matrigel (BD Bioscience, Belgium), then HUVECs (3.5 × 104 cells/well) seeded on top of Matrigel-coated wells. After 24 h, collected CMs from DU145 cells transfected by pAAV-sFLT01-HisTag-GFP or control, pAAV-MCS-GFP containing construct (supplemented with 10% FBS) were added and incubated for 18 h. To compare tube formation ability of groups, the number of master junctions along with the number of meshes from four randomly picked spots were evaluated under an inverted phase-contrast microscope (Olympus, Japan) and quantified with ImageJ software (AngioTool plugin).
Wound healing assay and cell invasion assay
To investigate the impact of sFLT01 on cancer cells migration, DU145 cells were seeded in a six-well plate at a density of 2 × 105 per well, and cultured for 24 h. When cultures developed to a near monolayer, a wound was made using the tip of a pipette and cells were treated with CM (from treated DU145 transfected by pAAV-sFLT01-HisTag-GFP or control which transected by pAAV-MCS-GFP). Following 24–48 h incubation, cells were fixed in a 3% formaldehyde solution for 15 min and imaged using different fields. The relative migration rates of DU145 cells were determined by dividing the migration distance by the time.
Invasion analysis was performed by using matrigel (BD Biosciences, San Jose, CA, USA) was added to the underside of each insert and left for 16 h at 37 °C in a 5% CO 2 atm. According to the manufacturer’s instruction. First, a mixture of 5 × 105 DU145 cells transfected by pAAV-sFLT01-HisTag-GFP or, control, pAAV-MCS-GFP transfected DU145 cells and serum-free media was prepared and added to the matrigel-coated transwell chambers (Nunc, Roskilde, Denmark) with 8.0 μm diameter pores. The chambers were then placed in the lower plate filled with 10% FBS containing media and maintained for 24 h at 37 °C under 5% CO2. After removing the non-invading cells, the cells were fixed in the chilled methanol for 20 min at − 20 °C. The plate was rewashed with the PBS buffer twice and stained with DAPI for the next 3 min. Cell analysis was carried out using a fluorescent microscope (Carl Zeiss, Germany).
