Materials
SP (6.7 μg/kg/0.1 ml) was purchased from Sigma (St. Louis, MO, USA). RP67580 (RP, a selective non-peptide tachykinin NK1R antagonist, 1 mg/kg) was obtained from R&D Systems Inc. (Minneapolis, MN, USA). Hoechst33342 and DAPI were purchased from Thermo Fisher Scientific (Rockford, IL, USA). AccuPower®RocketScript™ Cycle RT PreMix (dN12) and AccuPower®ProFi Taq PCR PreMix were purchased from Bioneer (DaeJeon, Korea). SYBR®Green Mix was obtained from Applied Biosystems (Lincoln, CA, USA). Antibodies that recognize GATA4 (ab86371), Nkx2.5 (ab91196), Nanog (ab106465), or goat anti-rabbit IgG H&L (Alexa Fluor®488, 594, and 647) were purchased from Abcam (Cambridge, UK). Antibodies specific for c-Kit (sc5535), Oct-3/− 4 (sc5279), Sox2 (sc2008), Isl-1 (sc101072), NK1R (sc15323), CD45 (sc25590), or actin (sc47778) were obtained from Santa Cruz Biotechnology, Inc. (CA, USA). Antibodies specific for phosphor-Akt (Ser473) (#9271) and Akt (#9272) were purchased from Cell Signaling Technology (MA, USA).
Animal experiment
Eight-week-old male Sprague-Dawley (SD) rats were used under a protocol approved by the Institutional Animal Care and Use Committee of Kyung Hee Medical Center (KHMC-IACUC:2015–028) [11, 27]. The SD rats were randomly divided into 4 groups (n = 22 each): sham, I/R, I/R with 5 nmole/kg SP injection (SP + I/R), and SP + I/R with 1 mg/kg RP injection (RP/SP + I/R). The SP and RP were injected via the tail intravenously as previously described [28, 29]. The left anterior descending coronary artery was occluded for 40 min followed by 1 day reperfusion with SP, with SP + RP, and without either. The SD rats were anaesthetized by using 2.5% isoflurane (Hana Pharm Co.,Ltd., Seoul, Korea). The rats were euthanized on 1 day, and the RA, LA, RV, LV, and apex derived from the heart samples were collected. According to Institutional Animal Care and Use Committee of Kyung Hee Medical Center standardized pain protocol, all SD rat continually was monitored for signs of distress. The SD rats were housed in the same pathogen-free facility under a 12 h light and dark cycle with ad libitum feeding. No more than three animals were housed per cage.
RA ex vivo explant outgrowth culture assay
RA tissue were cut into 1 to 2 mm fragments, washed with Ca2+/Mg2+ − free PBS, and digested three times for 10 min with 0.2% trypsin and 0.1% collagenase at 37 °C [11, 30]. The suspended cells and RA fragments were incubated with complete medium [CM; Dulbecco’s modified Eagle’s medium supplemented with 10% ES cell grade FBS, 5% horse serum, 10 ng/ml LIF, 1% penicillin-streptomycin, fungizone, and gentamicin] at 37 °C in a 5% CO2 incubator. After 2 weeks, the attached cells, which were surrounding the explants having migrated out, were analyzed by immunofluorescence with anti-c-Kit antibody. The c-Kit+ CPCs were purified by a magnet-activated cell sorting system (MACS)(Dynal Biotech, Oslo, Norway) [30]. RA explant-derived cells (EDCs) were suspended in trypsin, incubated with anti-c-Kit antibody (1100), and separated using immunomagnetic microbeads (Dynal Biotech). c-Kit+ CPCs were cultured for 1 month with CM at 37 °C in a 5% CO2 incubator. The c-Kit+ CPCs of the P2 passages were used for all experiments.
Cell proliferation assay
The cell proliferation assay was assessed using an EZ-Cytox cell viability assay kit (DoGEN, Seoul, Korea) [27]. After SP treatment for 7 days, the cultured medium was removed. Cells were stained with EZ-cytox solution for 1 h. Absorbance was determined at 490 nm using an ELISA reader (Emax; Molecular Devices, Sunnyvale, CA, USA).
Cell migration assay
To determine the priming effects of SP on c-Kit+ CPC migration, a cell migration assay was performed using 0.8 μm pore size, and 24 well transwell migration chambers coated with Type IV collagen (10 μg/ml) as previously described [27]. 1 × 104 c-Kit+ CPCs were seeded into the upper transwell chambers containing medium. Then the chamber was inserted into each well of 24-well plates containing 600 μl medium supplemented with or without SP at the indicated concentration. The chambers were then incubated for 24 h at 37 °C in a 5% CO2 incubator. The cells that migrated to the outer side of the membrane were stained with a crystal violet staining solution. The absorbance was determined at 590 nm using an ELISA reader (Emax; Molecular Devices, Sunnyvale, CA, USA).
Cardiosphere formation
c-Kit+ CPCs were incubated in Dulbecco’s MEM and Ham’s F12 (ratio 1:1; Sigma), bFGF (10 ng/ml), EGF (20 ng/ml), LIF (10 ng/ml), insulin-transferrin-selenite (Gibco), 1x B27 (Gibco), 1x N2 (Gibco), 1% penicillin-streptomycin, 1% fungizone, and gentamicin in the presence or absence of SP at the indicated concentration [30]. After 2 weeks, the cardiosphere formation of c-Kit+ CPCs was visualized with an Olympus BX51 microscope equipped with a 20x lens. The number of spheres was counted manually from brightfield images using the ImageJ cell counter plugin and expressed as a percentage. All bright-field images were selected with clone identities blinded and at least 20 random images were obtained from each well.
Cardiomyocyte differentiation
The medium for cardiomyocyte differentiation was composed of MEM Alpha, 10% FBS supplemented with 1 μM dexamethasone (Sigma), and 1 mM β-glycerophosphate (Sigma). The c-Kit+ CPCs were incubated with or without SP (10 nM) in cardiomyocyte differentiation medium for 4 weeks. Cardiomyocyte differentiation was determined by immunofluorescence staining with anti-α-actinin (1:100) antibody [30].
Quantitative reverse-transcription PCR (qRT-PCR)
cDNA was synthesized using AccuPower®RocketScript™ Cycle RT PreMix (dN12) (Bioneer, DaeJeon, Korea). qRT-PCR assays were carried out with SYBR®Green Mix and the appropriate primers (Applied Biosystems), and were run on a StepOnePlus real-time PCR system (Applied Biosystems). The relative gene expression from all data were obtained using the ΔCt method with normalization versus RPL-32 as previously described [27, 30]. The primers used were: NK1R (Forward-TACACTGTGGGGCCAGTGAGATC, Reverse-GGTACACACAACCACGATCATCA); c-KIT (Forward-AGACGTACAGATCCAGAATG, Reverse-TGCTCTTTGCTGTTACCTT); NANOG (Forward-CTCTCTACCATTCTGAACCTGAGC, Reverse-TCAGGCCGTTGCTAGTCTTC); OCT4 (Forward-GCCCCCATTTCACCACACT, Reverse-CCAGAGCAGTGACAGGAACA); SOX2 (Forward-GACAGCTACGCGCACATGAA, Reverse-CGAGCTGGTCATGGAGTTGT); GATA4 (Forward-ACCCTGCGAGACACCCCAAT, Reverse-GTAGAGGCCACAGGCGTTGC); RPL-32 (Forward- TGTCAAGGAGCTGGAAGTGC, Reverse-AGGCACACAAGCCATCTATTCA).
Immunofluorescence staining (IFS)
The tissue samples were fixed with 4% paraformaldehyde, embedded with paraffin, and sectioned into 7 μm-thick sections. The c-Kit+ CPCs were fixed with 4% paraformaldehyde. They were stained with standard IFS methods as previous described [2, 27, 30]. After nuclear DAPI or Hoechst 33342 staining, immunostained confocal images were acquired using an inverted Zeiss Axio Observer Z1 microscope with 405, 458, 488, 514, 561, and 633 nm laser lines. To calculate the quantification of c-Kit+ CPCs, we used microscope software ZEN from ZEISS microscopy which can count the number of c-Kit+ CPCs and number of total cells per field.
Western blot analysis
The frozen samples were disrupted using the TissueLyser II (Qiagen), after which an ice-cold PRP-PREP protein extraction solution with a protease inhibitor cocktail (iNtRON Biotechnology, Inc., Seoul, Korea) was added, and the samples were homogenized by stainless steel beads (Qiagen, Cam USA). Protein concentration was assessed using the BCA-kit (Thermo Scientific, Rockford, IL, USA). An equal amount of protein (80 μg) from each sample was loaded onto 10 to 12% SDS gel, and transferred to a PVDF membrane (Merk Millipore, MA, USA). The membranes were blocked for 2 h at room temperature with 5% nonfat dry milk in PBS containing 0.1% Tween-20, and incubated with primary antibodies (1:1000 and 1:500) overnight at 4 °C. After washing three times, the membranes were incubated with a horseradish peroxidase-conjugated secondary antibody (1:5000) at RT for 2 h and visualized with a chemiluminescence substrate.
Statistical analysis
Student’s t-tests (for comparisons of two groups) or a one-way analysis of variance (ANOVA) (for comparisons of three or more groups) followed by Tukey post hoc tests were used for the statistical analyses. SPSS software ver. 17.0 (SPSS, Chicago, IL) was used. A value of P < 0.05 was considered significant. Data are expressed as means ± standard error of the mean (SEM). Data analysis was carried out using the GraphPad Prism software (GraphPad Software Inc). *P < 0.05–0.01, **P < 0.01–0.001, and ***P < 0.001 vs. corresponding controls. All error bars represent the standard deviation of three or more biological replicates.